GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1315473

Query DataSets for GSM1315473

Status

Public on Mar 02, 2014

Title

BV2-RNAseq-notx-48h-Nmu

Sample type

SRA

Source name

BV2 cells

Organism

Mus musculus

Characteristics

cell line: BV2
cell type: microglial
htt status: mutant Human Htt overexpression
expression construct: Nmu (HTT mutant)

Treatment protocol

pCDH, Nwt, and Nmu Constructs: N-terminus human wild-type and N-terminus mutant huntingtin have been cloned from pCAG-Htt19550-15Q and pCAG-Htt1955-128Q respectively into MCS of pCDH-CMV-MCS-EF1-Puro (System Bioscience) using EcoRI and NotI. Lentiviral production and BV2 cells transduction were performed according to the manufacturer's protocol. Control cell line was generated by transducing BV2 cells with Lentivirus obtained from pCDH-CMV-MCS-EF1-Puro (empty vector). Validation of plasmids used in this study was performed by Western blotting.

Growth protocol

Murine microglial BV2 cells, primary mouse microglia, mouse astrocyte maintained with DMEM (Cellgro) supplemented with 10% FBS (low endotoxin, Hyclone) and penicillin/streptomycin (Invitrogen). Adult microglia Purification: Cortex, striatum, and hippocampus were extracted and gently homogenized in staining buffer (HBSS (Life Technologies, 14175-095), 1% BSA, 1mM EDTA) on ice using a 2 ml polytetrafluoroethylene pestle (Wheaton), first in a 14 ml round-bottom tube (BD Falcon, 352059) and then in a 2 ml grinder chamber (Wheaton, 358029). Homogenates were filtered onto a 70 ?m cell strainer (BD Falcon, 352350) and centrifuged for 10 min at 400g. Cell pellets were resuspended in 6 ml of 37% isotonic Percoll (Sigma, P4937) and then underlayed with 5 ml of 70% isotonic Percoll in a 15ml centrifuge tube (Corning, 430790). Tubes were then centrifuged at 600g for 40 min at 18°C, with no acceleration or decelaration. Cells at the 37?70% Percoll interface were recovered and washed once in 15 ml HBSS. Cell were then incubated in staining buffer on ice with CD16/CD32 (eBioscience, clone 93) antibody for 25 min, and then with CD11b-PE (BioLegend 101208, clone M1/70) and CD45- Alexa488 (BioLegend 103122, clone 3-F11) antibodies for 30 min. Cells were then washed once and filtered onto a 40 ?m cell strainer (BD Falcon, 352340). Sorting was performed on a BD Influx cell sorter. Microglia were defined as singlets, CD11b+CD45Low events, and emcompassed 90-95% of all CD11b+ events. BMDM Isolation: Bone marrow was harvested and washed once with PBS, seeded/cultured in DMEM containing 20 % FCS, 30 % L-cell conditioned media (as source of macrophage colony stimulating factor, M-CSF), and 100 U/ml penicillin/streptomycin in non-tissue culture-treated petri dishes. After 6-8 days of culture, non-adherent cells were washed off with room temperature PBS and macrophages were obtained as a homogeneous population of adherent cells which were scraped and subsequently seeded onto tissue culture-treated petri dishes overnight in RPMI 1640 containing 10% FCS, 100 U/ml penicillin/streptomycin, and 10ng/ml M-CSF.

Extracted molecule

polyA RNA

Extraction protocol

RNA was purified using RNeasy Mini Kit (Qiagen) and enriched for Poly(A)-RNA with MicroPoly(A) Purist Kit (Ambion). Subsequently, RNA was treated with TURBO DNase (Ambion), fragmented with RNA Fragmentation Reagents (Ambion) and purified by a P-30 column (Biorad).
Fragmented RNA was dephosphorylated with Antarctic phosphatase (New England Biolabs) heat inactivated and precipitated over-night. Poly(A)-tailing and cDNA synthesis was performed as previously described. For reverse transcription, oligos with custom barcodes (underlined) were used: 5′-Phos-CA/TG/AC/GT GATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTT TTTTTTTTTTTTTTTTVN-3′. Subsequently, exonuclease was used to remove the excess oligo. After heat-inactivation, RNA was hydrolyzed by alkaline treatment (100mM NaOH) and heat at 95°C for 25 min. The cDNA fragments of 50–150 nucleotides were purified on a denaturing Novex 10% polyacrylamide TBE-urea gel (Invitrogen). The recovered cDNA was circularized, linearized, amplified for 12 cycles, and gel purified as previously described. The library was sequenced on Illumina sequencers according to the manufacturer's instructions.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina Genome Analyzer IIx

Description

no treatment, 48h

Data processing

RNA-Seq: Reads were aligned to the mouse mm9 genome (NCBI Build 37) using STAR (v2.0.3e). RNA-Seq experiments were normalized and visualized by using HOMER (http://biowhat.ucsd.edu/homer/) to generate custom tracks for the UCSC Genome Browser (http://genome.ucsc.edu/). Gene expression values were generating for RefSeq annotated transcripts using HOMER and differential expression calculations were performed using edgeR.
RNA-Seq RPKM tab-delimited text file is available on series record. Columes: 1: RefSeq ID, 2: chr, 3: gene start, 4: gene end, 5: strand, 6: mRNA length, 7: Copies of gene in genome, 8: Annotation information, 9-18: RPKM gene expression values
Genome_build: mm9

Submission date

Jan 27, 2014

Last update date

May 15, 2019

Contact name

Christopher Benner

E-mail(s)

[email protected]

Organization name

University of California, San Diego (UCSD)

Department

Medicine