|
| Status |
Public on Feb 11, 2014 |
| Title |
Calling Cards - Tec1 insertions |
| Sample type |
SRA |
| |
|
| Source name |
yeast
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
transposon: Ty5
transcription factor: Tec1
|
| Treatment protocol |
Transposon induction occurred in media with 2% galactose
|
| Growth protocol |
Yeast were grown in synthetic low ammonium media
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Calling Card Illumina libraries were prepared by harvesting all His+ FOAr colonies and extracting their genomic DNA. Each DNA sample was divided into three aliquots and digested with Hinp1I or HpaII or TaqI. Digested DNA was ligated overnight at 15°C in dilute solution (<10ng/ul) to encourage self-circularization. After ethanol precipitation, self-ligated DNA was resuspended in ddH2O and used as template in an inverse PCR. Primers that anneal to Ty5 sequences (OM8714: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAATTCACTACGTCAACA; OM8827: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC) were used to amplify the genomic regions flanking Ty5 integrations and the bar codes within Ty5, as well as adding adapter sequences that allow the PCR products to be sequenced on the Illumina HiSeq 2000. The PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and diluted to 10nM.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
library strategy: Calling Card
Transposon insertions
|
| Data processing |
Illumina sequence reads were filtered by requiring the correct 17 bp LTR sequence in the first 17 bases of sequence from the read and an appropriate 8 bp barcode sequence. Reads were mapped using a seeded hash approach. The first 12 genomic bases of each read were mapped to the yeast genome. The remaining genomic fragments of each read were then aligned to the seeds using an ungapped alignment and allowing up to 2 mismatches on each read. Only insertions with unique reads were accepted.
genome build: Σ1278b
|
| |
|
| Submission date |
Feb 10, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
David Mayhew |
| E-mail(s) |
[email protected]
|
| Organization name |
GlaxoSmithKline
|
| Department |
Target Sciences, Computation Biology, R&D
|
| Street address |
1250 South Collegeville Road
|
| City |
Collegeville |
| State/province |
PA |
| ZIP/Postal code |
19426 |
| Country |
USA |
| |
|
| Platform ID |
GPL13821 |
| Series (1) |
| GSE54831 |
Transcription Factor Regulation and Chromosome Dynamics in Pseudohyphal Growth |
|
| Relations |
| BioSample |
SAMN02639578 |
| SRA |
SRX468865 |
