Cells were seeded at a density of 1x106 per 10 cm Petri dish 24 hours before treatment. Cells were then incubated with 8 ml of regular growth media at 37 ºC for 1 hour. At the end of the 1-hour incubation, the media was removed, cells washed twice in warm PBS, and incubated in drug-free media at 37 ºC for 10 hours.
Growth protocol
Cells were grown as a monolayer in RPMI 1640 media containing L-glutamine with 10% FCS, in the absence of antibiotics, in an incubator at 37 ºC with 5% CO2. Cells were passaged twice a week by trypsin/EDTA (0.05% trypsin, 0.7 mM EDTA) treatment. Cells were tested and confirmed to be free of mycoplasma contamination.
Extracted molecule
total RNA
Extraction protocol
After the 10 hour incubation post-cisplatin treatment, T-RNA was extracted by using TRIzol Reagent (Invitrogen, Paisley, UK), according to the manufacturer’s instructions. All additional reagents used were of molecular biology grade and purchased from Sigma (Poole, UK). Briefly, cells were lysed directly in the culture dish with 1 ml TRIzol Reagent and the resulting cell lysate passed several times through a pipette to achieve homogenisation. The homogenised samples were incubated in microcentrifuge tubes at room temperature for 5 minutes to permit the complete dissociation of nucleoprotein complexes. 200 µl of chloroform were added to each homogenised sample, tubes shaken vigorously by hand for 15 seconds and incubated at room temperature for 2 to 3 minutes. Samples were centrifuged at 12,000 × g for 15 minutes at 4 °C, after which the aqueous phase was transferred to a fresh tube. RNA was precipitated from the aqueous phase by mixing with 0.5 ml isopropyl alcohol. Samples were incubated at room temperature for 10 minutes and centrifuged at 12,000 × g for 10 minutes at 4 °C. Supernatant was removed and RNA pellet washed once with 1 ml of 75% ethanol. Samples were mixed by vortexing and centrifuged at 7,500 × g for 5 minutes at 4 ºC. At the end of the procedure, the RNA pellet was briefly air-dried for 5 to 10 minutes after which RNA was dissolved in an appropriate volume of RNase/DNase-free water, pre-warmed to 60 ºC, by passing the solution a few times through a pipette tip, and incubating for 10 minutes at 55 to 60 ºC. T-RNA concentration was determined by measuring the absorbance of a 1:100 diluted solution at 260 nm in a GeneQuant II RNA/DNA calculator spectrophotometer (Pharmacia Biotech, Cambridge, UK), assuming that if A260 = 1, the content equals 40 µg/ml of RNA. RNA purity was assessed by the ratio A260/A280. T-RNA integrity was investigated in the Agilent 2100 Bioanalyzer, by assessing size distribution of the T-RNA using the Eukaryote Total RNA Nano assay (Agilent Technologies, Palo Alto, California, USA), according to the manufacturer’s specifications.
Label
biotin
Label protocol
The SuperScript Double-Stranded cDNA Synthesis Kit (Invitrogen, Paisley, UK) was used to convert the mRNA in the T-RNA samples into ds-cDNA by reverse transcription with an oligo-dT primer. Initially, first strand cDNA was formed in a reaction containing 15 g of T-RNA and 100 pmol of T7-oligo (dT) primer (5’ – GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG - (dT)24 – 3’) (Proligo, France). This mixture was incubated at 70 °C for 10 minutes and quickly chilled on ice for 5 minutes, after which the following reagents were added: first strand reaction buffer [50 mM Tris-HCl (pH 8.3) 75 mM KCl, 3 mM MgCl2], 10 mM dithiothreitol (DTT) and 500 µM each dNTP. Tubes were placed at 42 °C for 2 minutes to equilibrate the temperature prior to the addition of Superscript II reverse transcriptase (400 U) and further incubated for 1 hour at 42 °C. The second strand cDNA synthesis was performed by adding, to the solution containing the first strand cDNA, 200 µM each dNTP, 10 U of E. coli DNA ligase, 40 U of E. coli DNA polymerase I, 2 U of E. coli RNase H and second strand reaction buffer [20 mM Tris-HCl (pH 6.9), 90 mM KCl, 4.6 MgCl2, 0.15 mM beta–NAD+, 10 mM (NH4)2SO4]. The reaction was incubated for 2 hours at 16 °C. Following this incubation, 10 U of T4 DNA polymerase were added and incubated for 5 minutes at 16 °C. The reaction was stopped by the addition of 31.25 mM EDTA. The resulting ds-cDNA was extracted against an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma, Poole, UK) using phase lock gels (Eppendorf, Cambridge, UK) and centrifuging at 12,000 × g for 2 minutes. The ds-cDNA was then precipitated from the aqueous phase by the addition of 0.5 volumes of 7.5 M ammonium acetate (Sigma, Poole, UK) and 2.5 volumes of absolute ethanol (Sigma, Poole, UK), using Pellet Paint (Novagen, Nottingham, UK) as a carrier. Pellet was washed in ethanol, dried and resuspended in an appropriate volume of RNase/DNase-free water (Sigma, Poole, UK). Synthesis of biotin labelled cRNA was performed by in vitro transcription using the BioArray HighYield RNA Transcript Labelling kit (ENZO, Farmingdale, USA), according to the manufacturer’s instructions. Briefly, ds-cDNA synthesised from above was used as template, and T7 RNA polymerase was added to perform the in vitro transcription reaction from the T7 RNA polymerase promoter in the template. Biotin-labelled ribonucleotides (Bio-CTP, Bio-UTP) were included in the reaction along with non-labelled ribonucleotides (ATP, GTP, CTP, UTP) to produce biotin-labelled cRNA molecules. The reaction was incubated at 37 °C for 5 hours. This step was followed by cRNA cleanup with RNeasy Mini columns according to the manufacturer’s specifications (Qiagen, Crawley, UK). Quantification and purity assessment of cRNA was performed in a spectrophotometer by measuring the absorbance at 260 and 280 nm and the adjusted cRNA yield calculated taking into account the carryover of unlabelled T-RNA by the following formula: adjusted cRNA yield = RNAm – (T-RNAi)(y), where RNAm is the amount of cRNA measured after the IVT reaction, T-RNAi is the starting amount of T-RNA and y is the fraction of cDNA used in the IVT reaction. Size distribution of the labelled transcripts was investigated in the Agilent 2100 Bioanalyzer using the Eukaryote Total RNA Nano assay (Agilent Technologies, Palo Alto, California, USA). The appropriate amount of cRNA (13 µg) was fragmented in a buffer containing 40 mM Tris-acetate (pH 8.1), 100 mM KOAc and 30 mM MgOAc for 35 minutes at 94 °C. An aliquot, containing at least 1 µg of cRNA, of each fragmented sample was analysed in a 1% agarose gel electrophoresis to confirm fragmentation efficiency.
Hybridization protocol
Fragmented cRNA was added to hybridisation buffer (100 mM 2-Morpholinoethanesulfonic acid (MES), 1 M [Na+], 20 mM EDTA, 0.01% Tween 20) with 0.1 mg/ml herring sperm DNA (Promega, Southampton, UK), 0.5 mg/ml acetylated bovine serum albumin (BSA) (Invitrogen, Paisley, UK). The hybridisation buffer was spiked with 50 pM control oligonucleotide B2 and the eukaryotic cRNA controls bioB, bioC, bioD and cre (1.5, 5, 25 and 100 pM respectively), all controls were from the GeneChip Eukaryotic Hybridisation Control Kit (Affymetrix, Santa Clara, California, USA). The hybridisation mixture was heated to 99 °C for 5 minutes, cooled to 45 °C for 5 minutes and centrifuged at 14,000 × g for 5 minutes to remove any insoluble material from the hybridisation mixture. Each hybridisation mixture containing 10 µg of fragmented biotin-labelled cRNA was hybridised to a pre-wetted (with hybridisation buffer) GeneChip Human Genome Focus (HG-Focus) array (Affymetrix, Santa Clara, California, USA) for 16 hours at 45 °C with permanent rotation at 60 rpm in a Hybridisation Oven 640 (Affymetrix, Santa Clara, California, USA). Probe array washing and staining were performed according to specific Gene Chip protocols (Affymetrix, Santa Clara, California, USA) in the Fluidics Station 400 (Affymetrix, Santa Clara, California, USA). Briefly, HG-Focus arrays were washed in a non-stringent wash buffer containing 6× SSPE (0.9 M NaCl, 0.06 M NaH2PO4, 0.006 M EDTA) (Cambrex, Berkshire, UK) and 0.01% Tween-20 at 25 °C, then with a stringent buffer containing 100 mM MES, 0.1 M [Na+], 0.01% Tween-20 at 50 °C. Following this wash, the probe arrays were stained with a solution containing 10 µg/ml of streptavidin-phycoerythrin (SAPE) conjugate (Invitrogen, Paisley, UK) dissolved in a buffer containing 100 mM MES, 1 M [Na+], 0.05% Tween 20 and 2 mg/ml acetylated BSA (Invitrogen, Paisley, UK). Following staining, the probe arrays were exposed to 3 µg/ml goat biotinylated anti-streptavidin antibody (Vector laboratories, Peterborough, UK) in a buffer as above containing 0.1 mg/ml normal goat IgG (Sigma, Poole, UK) and 2 mg/ml acetylated BSA (Invitrogen, Paisley, UK). Finally, the probe arrays were re-stained with SAPE as described above.
Scan protocol
Probe arrays were scanned twice at 570 nm using a GeneArray laser scanner (Agilent Technologies, Palo Alto, California, USA) and the fluorescence intensity of the scanned image registered in CEL intensity files.
Description
n/a
Data processing
DNA-Chip Analyser (dChip) software (Li and Wong 2001 PNAS, 98:31) was used to automatically select probes, detect outliers/artefacts, normalise the fluorescence intensity over multiple arrays and calculate model-based expression values from CEL intensity files.
