|
| Status |
Public on Sep 30, 2015 |
| Title |
KLF6_bait2_DMSO_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
HeLa B2 cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa
treatment protocol: none
chip antibody: none
|
| Growth protocol |
HeLa B2 cells were maintained as described in previous study (doi:10.1101/gr.118042.110). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% charcoal stripped fetal calf serum (FCS) for 72-96 hours before subsequent treatment and/or harvesting.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Libraries were prepared according to Illumina's instructions.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
4C PCR product. Barcode: CGATGACTTTCAAGGTGATC
|
| Data processing |
Illumina Casava software 1.8.2 used for basecalling of Hiseq2000 data.
Illumina RTA 1.6.47.1 used for basecalling of GAII data.
Library strategy: ChIP-seq. The reads were aligned to build version hg19 of the human genome using bwa (version 0.6.2) with default parameters. Only unique mapped reads were kept for downstream analysis. Reads from PCR duplicates were also removed. MACS (version 1.4.2), was used to identify regions of ChIP-seq enrichment over background using parameters -p 1e-9 –nomodel.
Library strategy: ChIA-PET. The first 72bp of each sequenced read carries the complete ChIA-PET ligation product (linker plus genomic DNA) was taken for the further analysis after trimming the ends of each read. Subsequently, single end sequenced reads were split at the linker ligation junction (linkerA/B-|-linkerA/B) and flipped to make the data compatible (similar to paired end sequencing reads) for the ChIA-PET data analysis pipeline (doi:10.1186/gb-2010-11-2-r22).
Library strategy: 4C-seq. The initial step in the 4C-seq analysis is the alignment of the sequencing reads to a reduced genome of sequences that flank DpnII sites (fragment ends). Repetitive fragment ends were excluded from subsequent analysis. The reduced genome was based on mouse genome hg19.
Genome_build: hg19
|
| |
|
| Submission date |
Sep 30, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Shuang-Yin Wang |
| Organization name |
RIMLS
|
| Department |
Molecular Biology
|
| Street address |
Geert Grooteplein 28
|
| City |
Nijmegen |
| ZIP/Postal code |
6525GA |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE61911 |
Glucocorticoid receptor and nuclear factor kappa-b affect 3D chromatin organization |
|
| Relations |
| BioSample |
SAMN03085355 |
| SRA |
SRX717890 |
