NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1590748 Query DataSets for GSM1590748
Status Public on Sep 02, 2015
Title Spruce_bud
Sample type SRA
 
Source name Bud, from one-year old branches
Organism Picea abies
Characteristics tissue type: bud
Growth protocol A Norway spruce tree in the University of Delaware Botanic Gardens (Newark, Delaware, USA)
Extracted molecule total RNA
Extraction protocol Total RNA was extracted from the four samples using the Purelink Plant RNA Reagent from Life Technologies (New York, USA) according to the manufacturer’s protocol.
PARE libraries were constructed as previously described in Zhai et al. (2014, Methods, 67:84-90) and sequenced on the Illumina HiSeq 2500 in the DNA Sequencing & Genotyping Center in the Delaware Biotechnology Institute (Newark, Delaware, USA).
 
Library strategy miRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Description small RNAs
Data processing Fastx toolkit was used for data pre-processing. Original .fastq files were converted to .fasta files using fastq_to_fasta command (fastq_to_fasta -v -r -i INPUT_FILE.fastq -o OUTPUT_FILE.fasta -Q 33);
Adaptor was trimmed using the fastx_clipper (fastx_clipper -a "TGGAATTCTCGGGTGCCAAGG" -c -v -i INPUT_FILE.fasta -o OUTPUT_FILE -l 15);
Trimmed read file was collapsed into tag_count file using fastx_collapser (fastx_collapser -i INPUT_FILE -o OUTPUT_FILE);
Collapsed reads were mapped to reference genome by Patman.
Genome_build: Pabies 1.0 (http://congenie.org/)
Supplementary_files_format_and_content: trimmed and collapsed read file in a tag_count formate. Only 18-21 nt long sRNAs were collected. In the .txt file, each row has two columns. The first column is a small RNA sequence, and the second column the read count of the sequence.
 
Submission date Jan 23, 2015
Last update date May 15, 2019
Contact name Rui Xia
E-mail(s) [email protected]
Organization name South China Agricultural University
Department Horticulture
Lab Xia
Street address 483 Wushan Rd, Tianhe
City Guangzhou
State/province Guangdong
ZIP/Postal code 510640
Country China
 
Platform ID GPL19695
Series (1)
GSE65248 PARE libraries for the identification of miRNA target genes in Norway spruce
Relations
BioSample SAMN03292521
SRA SRX851990

Supplementary file Size Download File type/resource
GSM1590748_Spruce_bud_tag_count.txt.gz 117.8 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap