|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Sep 02, 2015 |
Title |
Spruce_bud |
Sample type |
SRA |
|
|
Source name |
Bud, from one-year old branches
|
Organism |
Picea abies |
Characteristics |
tissue type: bud
|
Growth protocol |
A Norway spruce tree in the University of Delaware Botanic Gardens (Newark, Delaware, USA)
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted from the four samples using the Purelink Plant RNA Reagent from Life Technologies (New York, USA) according to the manufacturer’s protocol. PARE libraries were constructed as previously described in Zhai et al. (2014, Methods, 67:84-90) and sequenced on the Illumina HiSeq 2500 in the DNA Sequencing & Genotyping Center in the Delaware Biotechnology Institute (Newark, Delaware, USA).
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
small RNAs
|
Data processing |
Fastx toolkit was used for data pre-processing. Original .fastq files were converted to .fasta files using fastq_to_fasta command (fastq_to_fasta -v -r -i INPUT_FILE.fastq -o OUTPUT_FILE.fasta -Q 33); Adaptor was trimmed using the fastx_clipper (fastx_clipper -a "TGGAATTCTCGGGTGCCAAGG" -c -v -i INPUT_FILE.fasta -o OUTPUT_FILE -l 15); Trimmed read file was collapsed into tag_count file using fastx_collapser (fastx_collapser -i INPUT_FILE -o OUTPUT_FILE); Collapsed reads were mapped to reference genome by Patman. Genome_build: Pabies 1.0 (http://congenie.org/) Supplementary_files_format_and_content: trimmed and collapsed read file in a tag_count formate. Only 18-21 nt long sRNAs were collected. In the .txt file, each row has two columns. The first column is a small RNA sequence, and the second column the read count of the sequence.
|
|
|
Submission date |
Jan 23, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Rui Xia |
E-mail(s) |
[email protected]
|
Organization name |
South China Agricultural University
|
Department |
Horticulture
|
Lab |
Xia
|
Street address |
483 Wushan Rd, Tianhe
|
City |
Guangzhou |
State/province |
Guangdong |
ZIP/Postal code |
510640 |
Country |
China |
|
|
Platform ID |
GPL19695 |
Series (1) |
GSE65248 |
PARE libraries for the identification of miRNA target genes in Norway spruce |
|
Relations |
BioSample |
SAMN03292521 |
SRA |
SRX851990 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1590748_Spruce_bud_tag_count.txt.gz |
117.8 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|