 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 13, 2016 |
| Title |
2OMe-seq 1mM dNTPs (ESCs, Fibrillarin sh #2) |
| Sample type |
SRA |
| |
|
| Source name |
E14 Mouse Embryonic Stem Cells
|
| Organism |
Mus musculus |
| Characteristics |
cell type: E14 Mouse Embryonic Stem Cells
strain: 129/Ola
|
| Treatment protocol |
Custom shRNAs were constructed using the TRC hairpin design tool (http://www.broadinstitute.org/rnai/public/seq/search), and designed to target the 3’-UTR of the Fbl transcript (NM_007991). shRNAs with more than 14 consecutive matches to non-target transcripts were avoided. Hairpins were cloned into pLKO.1 vector (Addgene: 10878) and each construct was verified by sequencing. For mouse ESCs transfection, approximately 106 cells were seeded in a 6-well plate the day prior to transfection. Transfection was performed using Lipofectamine 2000 reagent (Invitrogen), following manufacturer protocol. Cells were maintained for 4 days in canonical medium supplemented with Puromycin (2 μg/ml for 1 day, 1 μg/ml for 3 days).
|
| Growth protocol |
Mouse embryonic stem cells E14 were grown on 0.1% gelatin-coated plates and maintained in DMEM (4.5g/L D-Glucose), supplemented with 15% heat-inactivated FBS, 0.1mM NEAA, 1mM Sodium Pyruvate, 0.1mM 2-Mercaptoethanol, 25U/ml penicillin, 25 μg/ml streptomycin and 1,500U/ml LIF, as previously described (Neri et al., 2013).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were washed twice in 1X PBS, and lysed by addition of 1ml ice-cold TRIzol (Invitrogen). RNA integrity measurements were performed using Fragment Analyzer™ (Advanced Analytical). All samples had RNA Quality Number (RQN) greater than 9.8.
For each experiment, 2 μg of total RNA were spiked-in with 100 ng of in vitro transcribed RNAs (where specified). 2OMe-seq libraries were prepared with minor changes to the protocol used for CIRS-seq (Incarnato et al., 2014). Briefly, reverse transcription was performed in a 20 μl reaction, using 1mM final dNTPs, 0.5U/μl AMV Reverse Transcriptase (NEB), and random hexamers fused with the reverse complement of the Illumina TruSeq RNA 3’ Adapter (CCTTGGCACCCGAGAATTCCANNNNNN). The reverse transcription reaction was conducted in 30 minutes at 42°C, followed by 10 minutes at 95°C to inactivate the AMV enzyme. Template RNA was degraded by addition of 1 μl of Ribonuclease H (Ambion), and 1 μl of RNase Cocktail Enzyme Mix (Ambion), followed by 30 minutes incubation at 37°C. cDNAs recovery, and excess adapter removal was performed using Agencourt Ampure XP beads (Beckman Coulter). Following cleanup, cDNAs were separated on a 10% TBE-Urea PAGE gel, and a gel slice corresponding to 70-300nt fragments was cut. DNA was recovered by passive diffusion in TE Buffer [10mM Tris-HCl, 1mM EDTA] for 16 hours at 37°C with moderate shaking. Following ethanol precipitation, an adapter corresponding to the reverse complement of the standard Illumina TruSeq Small RNA 5’ Adapter (GATCGTCGGACTGTAGAACTCTGAAC), modified with a 5’-P group and a 3’-C3 spacer, was ligated to cDNAs 3’-OH termini using 200 U of CircLigase II for 6 hours at 65°C. This approach allowed us to keep the strand-specificity of the library, so that each read started 1 nt downstream of the RT stopping point. The adapter-ligated cDNAs were then subjected to 15 cycles of PCR using standard Illumina TruSeq primers, and excess primers were removed using Agencourt Ampure XP beads. Libraries were pooled in equimolar amounts, and subjected to sequencing on the Illumina™ NextSeq 500 Sequencer.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Library strategy: 2OMe-seq
Raw reads were converted to FastQ, and examined using the FastQC tool (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). For each run, the first 5 nucleotides at 5’-end were trimmed using the fastx_trimmer tool of the FASTX-Toolkit suite. Reads were then clipped from 3’ adapter sequences (requiring a minimum match of 10 nucleotides), using the fastx_clipper tool of the FASTX-Toolkit suite, discarding reads shorter than 25 nucleotides (parameters: -a TGGAATTCTCGGGTGCCAAGG -l 25 -M 10 -Q 33; -a AGATCGGAAGAGCACACGTCT was replaced for Alkaline hydrolysis and 2OMe-seq Method #2 libraries, due to the different 3’ adapter used). Reads were mapped to the reference transcriptome, composed of 28S and 18S rRNA sequences, plus sequences of the 3 in vitro generated spike-ins (where included), using Bowtie v1.1.1 (parameters: -q -n 2 --norc -m 1 --best --strata).
Genome_build: Reads were mapped only to 18S and 28S rRNA sequence for each species. Accessions are as follows: Homo sapiens 18S (NR_003286), Homo sapiens 28S (NR_003287), Mus musculus 18S (NR_003278), Mus musculus 28S (NR_003279).
Supplementary_files_format_and_content: Processed data file in BEDGraph format are provided (Columns: Transcript ID, Position, Position +1, Number of reads mapping 1nt downstream).
|
| |
|
| Submission date |
Sep 15, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Danny Incarnato |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Groningen
|
| Department |
Molecular Genetics
|
| Street address |
Nijenborgh 7
|
| City |
Groningen |
| State/province |
Netherlands |
| ZIP/Postal code |
9747 AG |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE73065 |
High-throughput single-base resolution mapping of 2’-O-Methylated residues |
|
| Relations |
| BioSample |
SAMN04088195 |
| SRA |
SRX1247375 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1881623_Library11.bedgraph.gz |
37.0 Kb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
