|
| Status |
Public on May 25, 2016 |
| Title |
Hfq +CL rep2 |
| Sample type |
SRA |
| |
|
| Source name |
hfq::3xFLAG_UV-irradiated
|
| Organism |
Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Characteristics |
strain: JVS-1338
genotype/variation: hfq::3xFLAG
treated with: UV light (254 nm, 800 mJ/cm2) irradiation
clip antibody: M2 anti-FLAG monoclonal antibody attached to superparamagnetic iron impregnated agarose beads
clip antibody vendor: Sigma-Aldrich
clip antibody cat.#: M8823
molecule subtype: Hfq-bound RNA
|
| Treatment protocol |
When the cultures reached an OD600 of 2.0, half of each culture was irradiated with UV light (254 nm, 800 mJ/cm2) while the other half was left untreated.
|
| Growth protocol |
Salmonella Thyphimurium strain SL1344 containing either a hfq::3xflag allele (strain JVS-1338) or a csrA::3xflag allele (strain JVS-4317) was grown from single colonies in 10 ml LB medium at 37°C for 16 hours. The cultures were diluted 1:100 into 200 ml fresh LB medium and continued to grow at 37°C until an OD600 of 2.0 was reached.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Bacteria were lysed and the FLAG-tagged proteins was immunoprecipitated using a monoclonal anti-FLAG antibody. The samples were treated with benzonase nuclease, calf intestine phophorylase, and polynucleotide kinase in the presence of radioactive gamma-ATP. Samples were separated with SDS-PAGE and followed by transfer to nitrocellulose membranes. Radioactively labelled RNA-protein complexes were eluted from membranes and treated with Proteinase K. RNA was purified with phenol:chloroform extraction and ethanol precipitation.
Purified RNA was used as input for library preparation using the NEB Next Small RNA Library kit according to the manufacturer’s instructions.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
signal sample
|
| Data processing |
library strategy:CLIP-seq
Demultiplexing
Fastq quality trimming using FastX version 0.0.13 and a cut-off value of 20
Adapter trimming using cutadapt (Martin, 2011) version 1.7.1 (R1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, R2: GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT), discard empty reads
Filtering of reads without mate via cmpfastq (http://compbio.brc.iop.kcl.ac.uk/software/cmpfastq.php)
Collapsing of identical reads and conversion to FASTA format using FastUniq (Xu et al. 2012)
Size filtering: discard read pairs with at least one read shorter than 25 nt
Size filtering: discard read pairs with at least one read shorter than 12 nt (READemption 0.3.5, Förstner et al., 2014)
Read mapping using segemehl version 0.2.0 (READemption 0.3.5, Förstner et al., 2014)
Coverage calculation based on uniquely mapped reads (READemption 0.3.5, Förstner et al., 2014)
Coverage normalization based on DESeq2 (Love et al. 2014) size factors calculated during peak calling
Genome_build: NC_016810.1, NC_017718.1, NC_017719.1, NC_017720.1
Supplementary_files_format_and_content: wiggle
|
| |
|
| Submission date |
Oct 28, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Lei Li |
| Organization name |
University of California, Irvine
|
| Street address |
University of California, Irvine
|
| City |
Irvine |
| State/province |
CA |
| ZIP/Postal code |
92697 |
| Country |
USA |
| |
|
| Platform ID |
GPL20056 |
| Series (1) |
| GSE74425 |
Global RNA recognition patterns of post‐transcriptional regulators Hfq and CsrA revealed by UV crosslinking in vivo |
|
| Relations |
| BioSample |
SAMN04221100 |
| SRA |
SRX1392552 |
