NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2146924 Query DataSets for GSM2146924
Status Public on May 09, 2019
Title Sample_04
Sample type SRA
 
Source name whole embryos
Organism Nothobranchius furzeri
Characteristics strain: MZM0410
life style: anual
Stage: somite
diapause: no
Extracted molecule total RNA
Extraction protocol Extraction was done as described in Baumgart et al. 2012. (PMID:22487494)
library preparation was done using Illumina's TruSeq small RNA sample preparation kit following the manufacturer's instructions.
 
Library strategy miRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Data processing Sequence information was extracted in FastQ format using Illumina's CASAVA v1.8.2 (Sample_01, 05, 09-11, 15, 17) and bcl2fastq software v1.8.3 (Sample_02-04, 06-08, 12-14, 16)
The processing and annotation of small RNA-Seq raw data was performed using the R programming language (version 3.0.2) and the ShortRead Bioconductor package (Morgan et al., 2009). First, raw data were pre-processed with the following parameters: Quality filtering, eliminating all reads containing an “N”; Adapter trimming, by use of the function trimLRPatterns(), allowing up to 2 mismatches and using as adapter sequence "TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC".
Size filtering removed all the reads with length shorter 18 and longer 33 nucleotides.
Reads were aligned, resulting in a direct annotation and quantification. The alignment was divided in two steps, to allow the recognition and the annotation of the reads exceeding reference length. In fact, the algorithm of Bowtie 1.1.2 does not allow aligning longer reads to shorter references. Specifically, first we performed alignment against the reference (Danio rerio, miRBase v21) with up to 2 mismatches. In this step the reference used was the mature sequence of microRNAs. Each read was aligned using these criteria with Bowtie 1.0.0 (settings: “-q", "--threads 8 --best", "—norc”). The remaining reads, which could not align in the previous step, were used as reference for a second alignment step with Bowtie 1.1.2 (settings: -f", "-a", "--threads 8 --norc"). In this case, the annotated mature microRNAs were aligned against the reads.
The information obtained in the two alignment phases was conveyed in one single table, containing a list of all the retrieved sequences and their relative counts. Read counts were normalized to RPM (reads per million mappable reads).
Genome_build: Danio rerio, miRBase v21;
Supplementary_files_format_and_content: Excel file, containing samples metadata information, mapping statistics and RPMs of each sample
 
Submission date May 09, 2016
Last update date May 15, 2019
Contact name Marco Groth
E-mail(s) [email protected]
Organization name Leibniz Institute on Aging - FLI
Department Core Facility - Next Generation Sequencing
Street address Beutenbergstraße 11
City Jena
ZIP/Postal code 07747
Country Germany
 
Platform ID GPL19871
Series (1)
GSE81231 Sequencing of smallRNAs of fish embryos in somite stage
Relations
BioSample SAMN04962324
SRA SRX1750589

Supplementary data files not provided
SRA Run SelectorHelp
Processed data are available on Series record
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap