GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2146927

Query DataSets for GSM2146927

Status

Public on May 09, 2019

Title

Sample_07

Sample type

SRA

Source name

whole embryos

Organism

Nothobranchius furzeri

Characteristics

strain: GRZ x MZZW
life style: anual
Stage: somite
diapause: yes (1 month)

Extracted molecule

total RNA

Extraction protocol

Extraction was done as described in Baumgart et al. 2012. (PMID:22487494)
library preparation was done using Illumina's TruSeq small RNA sample preparation kit following the manufacturer's instructions.

Library strategy

miRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina HiSeq 2500

Data processing

Sequence information was extracted in FastQ format using Illumina's CASAVA v1.8.2 (Sample_01, 05, 09-11, 15, 17) and bcl2fastq software v1.8.3 (Sample_02-04, 06-08, 12-14, 16)
The processing and annotation of small RNA-Seq raw data was performed using the R programming language (version 3.0.2) and the ShortRead Bioconductor package (Morgan et al., 2009). First, raw data were pre-processed with the following parameters: Quality filtering, eliminating all reads containing an “N”; Adapter trimming, by use of the function trimLRPatterns(), allowing up to 2 mismatches and using as adapter sequence "TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC".
Size filtering removed all the reads with length shorter 18 and longer 33 nucleotides.
Reads were aligned, resulting in a direct annotation and quantification. The alignment was divided in two steps, to allow the recognition and the annotation of the reads exceeding reference length. In fact, the algorithm of Bowtie 1.1.2 does not allow aligning longer reads to shorter references. Specifically, first we performed alignment against the reference (Danio rerio, miRBase v21) with up to 2 mismatches. In this step the reference used was the mature sequence of microRNAs. Each read was aligned using these criteria with Bowtie 1.0.0 (settings: “-q", "--threads 8 --best", "—norc”). The remaining reads, which could not align in the previous step, were used as reference for a second alignment step with Bowtie 1.1.2 (settings: -f", "-a", "--threads 8 --norc"). In this case, the annotated mature microRNAs were aligned against the reads.
The information obtained in the two alignment phases was conveyed in one single table, containing a list of all the retrieved sequences and their relative counts. Read counts were normalized to RPM (reads per million mappable reads).
Genome_build: Danio rerio, miRBase v21;
Supplementary_files_format_and_content: Excel file, containing samples metadata information, mapping statistics and RPMs of each sample

Submission date

May 09, 2016

Last update date

May 15, 2019

Contact name

Marco Groth

E-mail(s)

[email protected]

Organization name

Leibniz Institute on Aging - FLI

Department

Core Facility - Next Generation Sequencing