|
| Status |
Public on Apr 23, 2017 |
| Title |
RNA-seq_siDICER_Rep2 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
cell type: human embryonic kidney cell line
condition: DICER siRNA treated
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from cells by using TRIzol reagent (Thermo Fisher Scientific) and treated with DNase I (Takara).
RNA-Seq Library-protocol
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
rRNA-depleted RNA-seq
|
| Data processing |
The base calling was done by CASAVA v1.8.2
Using cutadapt (ver 1.8.1) adapter sequences were removed with the following command : cutadapt -A GGAATTCTCGGGTGCCAAGG -g GTTCAGAGTTCTACAGTCCGACGATC for paired end libraries/ cutadapt -a TGGAATTCTCGGGTGCCAAGG for single end libraries
The processed reads were aligned using STAR (ver 2.3.0e Linux) with the following command : STAR --outFilterMultimapNmax 5 --outFilterMismatchNmax 4
Per library, read count on each gene was calculated using our in-house tool. Then, the read fold changes between control and DROSHA/DICER KD samples were calculated.
Genome_build: hg38
Supplementary_files_format_and_content: tab-delimited tsv files including DROSHA cleavage sites for each cell line
|
| |
|
| Submission date |
Jan 16, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Kyowon Jeong |
| Organization name |
Seoul National University
|
| Street address |
1 Gwanak-ro
|
| City |
Seoul |
| ZIP/Postal code |
08826 |
| Country |
South Korea |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE93650 |
Genome-wide mapping of DROSHA cleavage sites on primary microRNAs and novel substrates [RNA-seq] |
| GSE93653 |
Genome-wide mapping of DROSHA cleavage sites on primary microRNAs and novel substrates |
|
| Relations |
| BioSample |
SAMN06233940 |
| SRA |
SRX2495283 |
