 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 23, 2017 |
| Title |
fCLIP_HeLa_Replicate1 |
| Sample type |
SRA |
| |
|
| Source name |
HeLa cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa
cell type: human cervical cancer cell line
|
| Extracted molecule |
total RNA |
| Extraction protocol |
HEK293T and HeLa cells grown on a 150 mm plate were rinsed twice with 18 ml of phosphate-buffered saline (PBS) solution and fixed with 18 ml of PBS-diluted 0.1% formaldehyde solution (Electron Microscopy Science) at room temperature (RT) for 10 min. For quenching of formaldehyde crosslinking, 2 ml of 1.5 M glycine solution was added to the plate at RT for 10 min. Fixed cells were harvested and resuspended in 550 μl of CLIP Wash buffer (1X PBS, 0.1% SDS, 0.5% deoxycholate, and 0.5% NP-40). After 10 min, lysate was sonicated by using bioruptor (COSMO BIO) and then treated with 20 μl of DNaseⅠ (Takara) at 37 ℃ for 10 min. The lysate was then centrifuged at 16,100 g for 10 min at 4 ℃, and supernatant was used in immunoprecipitation. For immunoprecipitation, 25 μl of protein A sepharose beads (GE healthcare, 17-5138-01) was prewashed three times with 1 ml of CLIP Wash buffer, and 20 μg of rabbit monoclonal DROSHA antibody (Cell Signaling, #3364) was attached to the washed beads in 400 μl of CLIP Wash buffer at 4 ℃ for 4 hr. The antibody-bound beads were then washed twice with CLIP Wash buffer, and incubated with the prepared lysate supernatant at 4 ℃ for 4 hr. After incubation, immunoprecipitates were washed six times with CLIP Wash buffer. The crosslinked DROSHA-RNA complexes were eluted from beads and antibodies by incubating the immunoprecipitates in 300 μl of PK-7M Urea buffer (200 mM Tris-HCl pH 7.4, 100 mM NaCl, 20 mM EDTA, 2% SDS, and 7 M Urea) at 25 ℃ for 2 hr with 950 rpm and taking ~300 μl of supernatant after brief spin down of the immunoprecipitates. The crosslinked RNAs were then separated from DROSHA proteins by treating additional 300 μl of 20 mg/ml Proteinase K (Roche) to the supernatant and incubating the solution at 65 ℃ for 12 hr with 1000 rpm. The RNAs were finally purified from the solution by phenol extraction.
Purified RNAs were sequentially treated with DNaseⅠ (Takara), alkaline phosphatase (Takara), and T4 polynucleotide kinase (PNK, Takara), and RNA products were purified from each treatment by phenol extraction. After PNK treatment, RNAs were run on 10% Urea-PAGE gel to obtain 25-160 nt RNA fragments and exclude remaining free ATPs. RNAs were purified from the excised gel, and the extracted RNAs were ligated to 3ʹ adapters by using T4 RNA ligase 2, truncated KQ (T4 Rnl2tr R55K, K227Q) (NEB). To exclude remaining free 3ʹ adapters, ligation products were run on 10% Urea-PAGE gel and purified from the excised gel. The 3ʹ adapter-ligated RNAs were ligated to 5ʹ adapters by T4 RNA ligase 1 (NEB) and then reverse transcribed by using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) and RT primer. For Illumina sequencing, cDNA was amplified by PCR that utilized Phusion HF polymerase (Thermo Fisher Scientific), 5ʹ PCR primer, and 3ʹ PCR primer. Amplified cDNA library was purified from 6% acrylamide gel and sequenced on an Illumina HiSeq 2500 platform.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
A DROSHA fCLIP-seq sample from HeLa
|
| Data processing |
The base calling was done by RTA (Real Time Analysis. v1.18)
Using cutadapt (ver 1.8.1) 5p and 3p adapter sequences were removed with the following command : cutadapt -O 5 -g TACAGTCCGACGATC -A TGGAATTCTCGGGTGCCAAGG
The paired end reads were joined using pear (ver 0.9.0) with the following command : pear -n 50
The processed reads were aligned using STAR (ver 2.3.0e Linux) with the following command : STAR --outFilterMultimapNmax 5 --outFilterMismatchNmax 4
Per cell line, aligned BAM files were merged using samtools (ver 0.1.19, with the command : samtools merge), then merged file were used to find DROSHA cleavage sites using our in-house tool
Genome_build: hg38 for HEK293T and HeLa
Supplementary_files_format_and_content: tab-delimited tsv files including DROSHA cleavage sites for each cell line
|
| |
|
| Submission date |
Jan 16, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Kyowon Jeong |
| Organization name |
Seoul National University
|
| Street address |
1 Gwanak-ro
|
| City |
Seoul |
| ZIP/Postal code |
08826 |
| Country |
South Korea |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE93651 |
Genome-wide mapping of DROSHA cleavage sites on primary microRNAs and novel substrates [fCLIP-seq] |
| GSE93653 |
Genome-wide mapping of DROSHA cleavage sites on primary microRNAs and novel substrates |
|
| Relations |
| BioSample |
SAMN06233933 |
| SRA |
SRX2495290 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
