|
| Status |
Public on Sep 01, 2018 |
| Title |
H1N1_6hr [miRNA] |
| Sample type |
SRA |
| |
|
| Source name |
macrophage cell type
|
| Organism |
Homo sapiens |
| Characteristics |
sample type: Low virulence
time post infection: 6hr
molecule: rRNA-depleted RNA
|
| Treatment protocol |
Primary human macrophage was separated from peripheral-blood leucocytes from healthy blood donors. The macrophages were seeded onto tissue culture plates in RPMI 1640 medium (Sigma-Aldrich) supplemented with 5% heat-inactivated autologous plasma.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The macrophages were infected with H1N1 and H5N1 separately at a MOI of two. The cells were washed with warm culture medium and incubated in macrophage serum free medium (Invitrogen) supplemented with 0.6 mg/l penicillin and 60 mg/l streptomycin. The total RNA was extracted from cells at 1-, 3-, and 6-hr post-infection using the mirVana miRNA Isolation Kit (Ambion, Inc. TX, USA).
Small RNA library was prepared from rRNA-depleted RNA from 1 µg of total RNA. The 3’ adapter (5’-rAppAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG/3ddC/-3’, 3ddC represents a 3’ OH blocking group) that had an adenylated 5’-end and a ddC 3’-end was ligated to the 3’ end of the RNA using T4 RNA Ligase 2 (NEB, Ipswich, MA). The 5’ adapter (5’-rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU-3’) ligation was performed using T4 RNA Ligase 1 (NEB, Ipswich, MA). The ligation product was used as template for cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen) and an oligonucleotide with sequence complementary to 3’ adapter as RT primer (5’-CTCGGCATTCCTGCTGAACCGCTC–3’).
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Data processing |
Basecalls performed using Illumina pipeline version 1.3.
The small RNA sequencing reads were trimmed with low-quality ends and primer adapters. The trimmed high-quality reads were mapped to the miRBase database (http://www.mirbase.org/) using CLC Genomics Workbench. Due to the imperfect Dicer processing, a 5 bp overhang on the 5’- and 3’-end of mature/mature* miRNAs and 2 mismatches within the mature/mature* miRNAs were allowed. The abundance level of mature/mature* miRNA is measured with RPM (Reads mapped Per Million mappable reads), by normalizing to the total number of mapped reads for each sample. The relative abundance of miRNAs was evaluated by comparing the RPM between H1N1/H5N1 infection and mock infection and the significance was assessed with Z-score using Z-test.
Supplementary_files_format_and_content: Excel file containing the normalized miRNA expression (RPM) and differential expression values (including fold-change and Z-score).
|
| |
|
| Submission date |
May 18, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Yunjuan Bao |
| Organization name |
University of Notre Dame
|
| Street address |
1234 Notre Dame Avenue
|
| City |
Notre Dame |
| State/province |
Indiana |
| ZIP/Postal code |
46556 |
| Country |
USA |
| |
|
| Platform ID |
GPL9115 |
| Series (2) |
| GSE99054 |
Whole transcriptome analysis of human macrophages infected with H5N1 and H1N1 influenza viruses reveals the significant up-regulation of RIG-I-like receptor signaling pathway [miRNA-seq] |
| GSE99079 |
Whole transcriptome analysis of human macrophages infected with H5N1 and H1N1 influenza viruses reveals the significant up-regulation of RIG-I-like receptor signaling pathway |
|
| Relations |
| BioSample |
SAMN07139962 |
| SRA |
SRX2833317 |
