 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 23, 2018 |
| Title |
BL08 |
| Sample type |
SRA |
| |
|
| Source name |
BL-Hi-C experiment with enzyme HindIII, two-step ligation, rep1
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: K562
restriction enzyme: HindIII
proximity ligation: two-step ligation
|
| Growth protocol |
K562 cell line was cultured according to manufacturer's instructions
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
BL-Hi-C: cells were cross-linked with formaldehyde and then nucleuses were isolated for lysis. Then the chromatin was fragmented with restriction enzymes (HaeIII, MboI or HindIII) and the proximal ends were ligated (one-step or two-step) with biotin-labeled bridge linker in situ. A whole genome chromatin was extracted and sheared into 300-500 bp. Then the biotinylated junctions were captured by M-280 streptavidin magnetic beads.
The BL-Hi-C libraries were prepared according to the standard Illumina library construction protocol and sequenced on the HiSeq2500/HiSeq X Ten.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Library strategy: BL-Hi-C
We used software ChIA-PET2 to process BL-Hi-C sequencing data, including linker trimming, reads alignment (BWA), paired-end tags formation and duplicates removal (two-step ligation parameters: -m 1 -k 2 -e 1 -A ACGCGATATCTTATC -B AGTCAGATAAGATAT; one-step ligation parameters: -m 2 -k 2-e 1 -A AGCTGAGGGATCCCTCAGCT -B AGCTGAGGGATCCCTCAGCT ).
Genome_build: GRCh37/hg19
Supplementary_files_format_and_content: bedpe format: Chromosome 1, Start 1, End 1, Chromosome 2, Start 2, End 2, ID, ., Strand 1, Strand 2
|
| |
|
| Submission date |
Jul 28, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Zhengyu LIANG |
| E-mail(s) |
[email protected]
|
| Organization name |
Southern University of Science and Technology
|
| Department |
Department of Biology
|
| Lab |
Zhengyu Liang
|
| Street address |
1088 Xueyuan Avenue
|
| City |
Shenzhen |
| State/province |
Guangzhou |
| ZIP/Postal code |
518055 |
| Country |
China |
| |
|
| Platform ID |
GPL20795 |
| Series (1) |
| GSE93921 |
BL-Hi-C is an efficient and sensitive approach for capturing structural and regulatory chromatin interactions |
|
| Relations |
| BioSample |
SAMN07422135 |
| SRA |
SRX3045517 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2721790_BL08.bedpe.gz |
158.4 Mb |
(ftp)(http) |
BEDPE |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
