NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2721793 Query DataSets for GSM2721793
Status Public on Jan 23, 2018
Title BL11
Sample type SRA
 
Source name BL-Hi-C experiment with enzyme HaeIII, one-step ligation, rep2
Organism Homo sapiens
Characteristics cell line: K562
restriction enzyme: HaeIII
proximity ligation: one-step ligation
Growth protocol K562 cell line was cultured according to manufacturer's instructions
Extracted molecule genomic DNA
Extraction protocol BL-Hi-C: cells were cross-linked with formaldehyde and then nucleuses were isolated for lysis. Then the chromatin was fragmented with restriction enzymes (HaeIII, MboI or HindIII) and the proximal ends were ligated (one-step or two-step) with biotin-labeled bridge linker in situ. A whole genome chromatin was extracted and sheared into 300-500 bp. Then the biotinylated junctions were captured by M-280 streptavidin magnetic beads.
The BL-Hi-C libraries were prepared according to the standard Illumina library construction protocol and sequenced on the HiSeq2500/HiSeq X Ten.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model HiSeq X Ten
 
Data processing Library strategy: BL-Hi-C
We used software ChIA-PET2 to process BL-Hi-C sequencing data, including linker trimming, reads alignment (BWA), paired-end tags formation and duplicates removal (two-step ligation parameters: -m 1 -k 2 -e 1 -A ACGCGATATCTTATC -B AGTCAGATAAGATAT; one-step ligation parameters: -m 2 -k 2-e 1 -A AGCTGAGGGATCCCTCAGCT -B AGCTGAGGGATCCCTCAGCT ).
Genome_build: GRCh37/hg19
Supplementary_files_format_and_content: bedpe format: Chromosome 1, Start 1, End 1, Chromosome 2, Start 2, End 2, ID, ., Strand 1, Strand 2
 
Submission date Jul 28, 2017
Last update date May 15, 2019
Contact name Zhengyu LIANG
E-mail(s) [email protected]
Organization name Southern University of Science and Technology
Department Department of Biology
Lab Zhengyu Liang
Street address 1088 Xueyuan Avenue
City Shenzhen
State/province Guangzhou
ZIP/Postal code 518055
Country China
 
Platform ID GPL20795
Series (1)
GSE93921 BL-Hi-C is an efficient and sensitive approach for capturing structural and regulatory chromatin interactions
Relations
BioSample SAMN07422132
SRA SRX3045520

Supplementary file Size Download File type/resource
GSM2721793_BL11.bedpe.gz 1.6 Gb (ftp)(http) BEDPE
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap