GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2995157

Query DataSets for GSM2995157

Status

Public on Oct 17, 2018

Title

PUM1CLIP_293T_NoDice_2-20_rep2

Sample type

SRA

Source name

293T_NoDice_2-20

Organism

Homo sapiens

Characteristics

cell line: 293T
dicer protein status: NoDice_2-20 KO
cliped protein: PUM1

Growth protocol

Cells were grown in DMEM (Corning Cellgro) with 10 % Fetal Bovine Serum (HyClone) and 10 units/ml of Penicillin-Streptomycin (HyClone). Cultured plates were grown in a humidified incubator at 37 °C with 5 % CO2

Extracted molecule

total RNA

Extraction protocol

Cells were crosslinked, lysed and immunoprecipitated with antibodies against endogenous PUM1 or PUM2 as described in the Materials and Methods
The HITS-CLIP (CLIP-seq) protocol for library construction was performed, as described in the Materials and Methods

Library strategy

RIP-Seq

Library source

transcriptomic

Library selection

other

Instrument model

Illumina HiSeq 2500

Description

crosslinked PUM1-bound RNA
Pum1Peaks.bed

Data processing

3' adapter (GTGTCAGTCACTTCCAGCGG) was clipped off and the resulting reads filtered for a length of 20nt or more (4nt random ligation barcode + G + 15nt of insert)
reads that have identical barcode + G + insert (i.e. PCR duplicates) were collapsed to unique reads and filtered for the presence of G at position 5
4nt barcode + G were trimmed off, and remaining insert (peak) sequences collapsed to unique sequences, preserving their count of barcodes (unique 5' ligation events during library construction) as the readcount for quantification
reads were aligned by bowtie2 to the hg19 genome build; unmapped reads were further mapped by Tophat to a transcriptome file combining refseq gene information and lincRNAs; matches with a mapping quality of 20 or more were retained; distinct reads with identical mapping coordinates (i.e. sequencing or allelic variants) were collapsed by readcount
reads were annotated by microRNA, refseq/lincRNA, and repeatmasker annotation positions
combined reads from all conditions were pooled to define peaks using FindPeaks4, and readcounts underneath each peak were re-extracted for each replicate
peak readcounts were filtered for a sum of more than 6 (for PUM1) or 3 (for PUM2) across all replicates, and peak signal and differential signal was computed by DESeq2, and further intersected with external data on mRNA level changes as described
Genome_build: hg19
Supplementary_files_format_and_content: tab-delimited text, extended .bed file with processed, filtered PUM peak coordinates, annotations, quantification and overlap information

Submission date

Feb 13, 2018

Last update date

Mar 04, 2023

Contact name

Fedor Karginov

E-mail(s)

[email protected]

Organization name

UC Riverside

Department

MCSB