 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 01, 2018 |
| Title |
CoIP_Cas9 chromosomally Flag tagged (positive) OD600 0.5 |
| Sample type |
SRA |
| |
|
| Source name |
CoIP_Cas9 chromosomally Flag
|
| Organism |
Neisseria meningitidis 8013 |
| Characteristics |
description: Cas9-Flag chromosomally tagged; CoIP(positive) at OD600 0.5
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Samples for RNA-Seq were collected from bacterial cul- tures grown to optical densities (OD)600 of 0.5 or 1.5, corre- sponding to the mid logarithmic and late logarithmic/early stationary growth phase, respectively. Samples were fixated by the addition of STOP Mix [95% (vol/vol) EtOH and 5% (vol/vol) phenol], frozen in liquid nitrogen and subsequently stored at−80◦C untilRNA preparation. For RNA extraction frozen bacterial cultureswere thawed on ice, cen- trifuged and cell pellets were resuspended in a lysis solution consisting of 800 ?l of 0.5 mg/ml lysozyme in Tris-EDTA (TE) buffer (pH 8.0) and 80 ?l 10% sodium dodecyl sul- phate (SDS). Bacterial cells were lysed by placing the sam- ples for 1–2 min at 65◦C in a water bath. Total RNA was extracted fromthe lysates using the hot phenol method. N. meningitidis expressing either 3× FLAG-tagged- or wild-type (WT) Cas9 protein were grown in the presence of kanamycin until an OD600 of 0.5 and 1.5, respectively. For each strain cells equivalent to an OD600 of 50 were collected and subjected to Cas9 coIP and control coIP as described in detail in ref.14 and briefly in the Supplementary Materials and Methods.
cDNA libraries of RNA-seq and RIP-seq samples were constructed by Vertis Biotechnology AG, Munich, Germany. cDNA libraries were pooled and sequenced using a MiSeqmachine in the single-read mode.
RNA-seq with wild type and Cas9 mutant and RIP-seq RNA co-immunoprecipitation (coIP) with Cas9
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Sample 6 NH_56
|
| Data processing |
Demultiplexing
Fastq quality trimming using FastX version 0.0.13 and a cut-off value of 20
Adapter trimming using cutadapt (Martin, 2011) version 1.7.1 (R1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, R2: GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT), discard empty reads
Size filtering: discard read pairs with at least one read shorter than 12 nt (READemption 0.3.5, Förstner et al., 2014)
Read mapping using segemehl version 0.2.0 (READemption 0.3.5, Förstner et al., 2014),Coverage calculation based on uniquely mapped reads (READemption 0.3.5, Förstner et al., 2014)
Genome_build: NC_017501.fa
Supplementary_files_format_and_content: wiggle
|
| |
|
| Submission date |
Feb 20, 2018 |
| Last update date |
May 01, 2018 |
| Contact name |
Lei Li |
| Organization name |
University of California, Irvine
|
| Street address |
University of California, Irvine
|
| City |
Irvine |
| State/province |
CA |
| ZIP/Postal code |
92697 |
| Country |
USA |
| |
|
| Platform ID |
GPL24628 |
| Series (1) |
| GSE110891 |
The CRISPR/Cas system in Neisseria meningitidis affects bacterial adhesion to human nasopharyngeal epithelial cells |
|
| Relations |
| BioSample |
SAMN08569781 |
| SRA |
SRX3729168 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3018357_NH_56_Neisseria_-TEX_forward.wig.bz2 |
923.9 Kb |
(ftp)(http) |
WIG |
| GSM3018357_NH_56_Neisseria_-TEX_reverse.wig.bz2 |
787.5 Kb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
