 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 06, 2019 |
| Title |
HEK293T EXOSC10CAT rep 1 (iCLip-seq) |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T EXOSC10CAT
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
antibody: anti-FLAG M2 magnetic beads) (Sigma Aldrich)
adapter: AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
barcode: NNNCCGGNN
treatment: HEK293T transiently expressed 3xFLAG-EXOSC10CAT, EXOSC10CAT protein associated RNA
molecule subtype: EXOSC10CAT bound RNA
|
| Treatment protocol |
Transfection of 3xFLAG-EXOSC10CAT expression vector 48 hours before collection
|
| Growth protocol |
HEK293T cell lines were maintained in DMEM with 10% fetal bovine serum at 37 °C and 5% CO2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
EXOSC10CAT associated RNA selected by crosslinking and IP. A detailed iCLip protocol can be found by Konig J., Zarnack K., Rot G., Curk T., Kayikci M., Zupan B., Turner D.J., Luscombe N.M. and Ule J. (2011).
EXOSC10CAT associated RNA were prepared using the protocol outlined by Konig J., Zarnack K., Rot G., Curk T., Kayikci M., Zupan B., Turner D.J., Luscombe N.M. and Ule J. (2011).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
45srDNA.fa
45srDNA.annotation.bed
EXOSC10-CAT.45srDNA.bw
EXOSC10-CAT.hg38.antisense.bw
EXOSC10-CAT.hg38.sense.bw
|
| Data processing |
[Preprocessing - Demultiplex] flexbar --format i1.5 --barcode-trim-end LEFT_TAIL --barcode-keep --pre-trim-phred 30 --min-read-length 28 --adapter-min-overlap 4
[Preprocessing - Collapsing Redundant Reads] nonRedundant reads were collapsed using custom perl scripts
[Preprocessing - Barcode Removal] fastx_trimmer -f 10 -m 20 -z
[Preprocessing - Merge] biological replicate samples were combined to increase coverage
[Alignment] Tophat VN:2.0.14 --max-multihits 1 --library-type fr-firststrand --num-threads 8 --no-novel-juncs --no-coverage-search --no-novel-indels
[Normalization] bigwig files scaled to reads mapped per million
Genome_build: GRCh38
Supplementary_files_format_and_content: bigwig files are coverage tracks that have been scaled based on reads mapped per million (RPM).
|
| |
|
| Submission date |
Sep 27, 2018 |
| Last update date |
Mar 06, 2019 |
| Contact name |
Steven West |
| E-mail(s) |
[email protected]
|
| Phone |
0044(0)1392727458
|
| Organization name |
University of Exeter
|
| Department |
Living Systems Institute
|
| Street address |
Stocker Rd
|
| City |
Exeter |
| State/province |
Devon |
| ZIP/Postal code |
EX4 4QD |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE120574 |
The immediate impact of exoribonucleolysis on nuclear RNA processing, turnover and transcriptional control revealed by rapid depletion of DIS3, EXOSC10 or XRN2 from human cells |
|
| Relations |
| BioSample |
SAMN10138456 |
| SRA |
SRX4745218 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
