GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3898670

Query DataSets for GSM3898670

Status

Public on Dec 09, 2019

Title

S13 AQP5+

Sample type

SRA

Source name

Gastric pylorus

Organism

Homo sapiens

Characteristics

health status: Normal
aqp5 expression: AQP5+

Growth protocol

Healthy pylorus tissue was resected from patients undergoing surgery to remove gastric tumour. Resected tissue was collected in Advanced DMEM/F-12 media with 10mM HEPES, 2mM Glutamax (incubation buffer, all from Life Technologies), supplemented with 1X Anti-Anti (Life Technologies) and 1mM N-acetylcysteine (Sigma).

Extracted molecule

total RNA

Extraction protocol

After at least three washes in HBSS, the pylorus was chopped finely and digested in incubation buffer supplemented with 1mg/mL Collagenase (Gibco) and 2mg/mL Bovine Serum Albumin (Sigma) for 30min at 37oC with intermittent mixing. Glands were isolated by repeated pipetting of finely chopped pylorus tissue in cold chelation buffer. Chelation buffer containing isolated glands was filtered through 100μm filter mesh, and centrifuged at 720g at 4oC for 3 min. The pellet was resuspended in TrypLE (Life Technologies) with DNaseI (0.8U/μL)(Sigma) and incubated at 37oC for 10 min with intermittent trituration for digestion into single cells. Digestion was quenched by dilution with cold HBSS buffer. The suspension was centrifuged at 720g at 4oC for 3 min. For anti-Aqp5 antibody stain, the pellet was resuspended in HBSS with 2% fetal bovine serum (FBS, Hyclone) with anti-Aqp5-AF647 (Abcam, ab215225) at 1:500 dilution and incubated on ice at 30min in the dark. The pellet was subsequently washed twice with cold HBSS and spun at 800g for 3min at 4oC. The pellet was resuspended in HBSS with 2% fetal bovine serum (FBS, Hyclone). Before sorting, 1 μg/ml propidium iodide (Life Technologies) was added to the cell suspensions, filtered through a 40μm strainer, and sorted on BD Influx Cell Sorter (BD Biosciences). Cells were collected in RLT Plus buffer (Qiagen) for subsequent RNA extraction with RNeasy Micro Kit according to manufacturer's instructions.
Library was constructed with 10ng of input RNA using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian according to manufacturer's instructions.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2500

Description

DifferentialExpression_AQP5_RNAseq_forGEO.txt
processed data header: Set13_Plus

Data processing

Illumina Real-Time Analysis (RTA) software
Read Mapping: STAR version 2.5.3a with the following options issued: --outFilterType BySJout, --outFilterMultimapNmax 10, --alignSJoverhangMin 15, --alignSJDBoverhangMin 1, --outFilterMismatchNmax 12, --outFilterMatchNminOverLread 0.4, --alignIntronMin 20, --alignIntronMax 2000000, --outSAMattrIHstart 0, --outSAMmapqUnique 244, --outMultimapperOrder Random, --outReadsUnmapped None, --outFilterIntronMotifs None, --outSAMmode Full, --outSAMattributes All --quantMode GeneCounts, --clip3pAdapterSeq AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Counts per sample were concatenated in R version 3.2.3
Read Normalisation: TMM normalisation as implemented in edgeR version 3.12.1 (with limma_3.26.9).
Differential expression testing was performed with the edgeR function “glmQLFit” using a design matrix that took sample batches and AQP5 status into account.
Genome_build: GRCh38.p12
Supplementary_files_format_and_content: tab-delimited text file include normalized read counts for individual samples, log2 fold change and FDR across AQP5+ and AQP5- samples.

Submission date

Jun 19, 2019

Last update date

Dec 09, 2019

Contact name

Si Hui Tan

Organization name

Institute of Medical Biology

Street address

8A Biomedical Grove #06-06 Immunos

City

Singapore