|
| Status |
Public on Jun 24, 2020 |
| Title |
Rpa190HTP_wt_25rDNA_2 |
| Sample type |
SRA |
| |
|
| Source name |
Rpa190-HTP 25 rDNA
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: BY4741
|
| Treatment protocol |
Protein-RNA complexes were stabilised by in-vivo UV crosslinking. PAR-CRAC samples were treaded with 1 mM SU 15 min before cross-linking.
|
| Growth protocol |
S.cerevisiae strains expressing C-terminal HTP tagged proteins were grown at 30°C to A600 ∼ 0.5 in synthetic medium with glucose minus tryptophan.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
UV stabilized protein-RNA interactions were purified under denaturing conditions and RNAs associated with HTP tagged protein were partially truncated.
Sequencing 3' adapter and 5' adapter were ligated while protein-RNA complexes were bound to Ni-NTA agarose, RNA library was reverse transcribed and PCR amplified.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiniSeq |
| |
|
| Description |
nascent RNA
nascent RNA covalently attached to RNAPI
NNNATTAGC_Rpa190HTP_wt_25rDNA_2
|
| Data processing |
Demultiplexing: Reads were assigned to experimental samples using their 5' barcode sequences, and barcodes were kept. Barcode is always first segment of each name: NNNCGCTTAGC_Rpa190HTP_wt_1.fastq NNNTAAGC_Rpa190HTP_wt_2.fastq NNNATTAGC_Rpa190HTP_wt_3.fastq NNNCGCTTAGC_Rpa190HTP_wt_4.fastq NNNGTGAGC_Rpa190HTP_wt_5.fastq NNNCACTAGC_Rpa190HTP_wt_6.fastq NNNCGCTTAGC_Rpa190HTP_wt_UVA_1.fastq NNNATTAGC_Rpa190HTP_wt_UVA_2.fastq NNNATCACGN_Rpa190HTP_wt_60s_1.fastq NNNCTAGC_Rpa190HTP_wt_80s_1.fastq NNNCACTGTN_Rpa190HTP_wt_80s_2.fastq NNNTGGAGC_Rpa190HTP_wt_100s_1.fastq NNNGTGACAN_Rpa190HTP_wt_100s_2.fastq NNNATTAGC_Rpa190HTP_wt_25rDNA_1.fastq NNNATTAGC_Rpa190HTP_wt_25rDNA_2.fastq NNNGACTTAGC_Rpa135HTP_wt_1.fastq NNNTAAGC_Rpa135HTP_wt_2.fastq NNNGTGAGC_Rpa190HTP_hmo1d_1.fastq NNNGTGAGC_Rpa190HTP_hmo1d_2.fastq
Collapsing reads: To remove PCR duplicates, reads were collapsed usinf fastx_collapser, part of FASTX Toolkit 0.0.14
Debrarcoding: The 5' barcodes were removed using pyBarcodeFilter.py v3.0 script from pyCRAC package.
Filtering reads: Reads were trimmed using flexbar v3.4.0 to remove the 3 -linker sequence (TGGAATTCTCGGGTGCCAAGGC) and were additionaly filtered and only 3'linker-containing reads were included to further analyses.
Reads alignment: Reads were aligned to the Saccharomyces cerevisiae genome sequence (Ensembl release EF4.74) by novoalign version 2.07.00.
Additional processing: novoalign SAM reads were modified using custom made script to keep only the 5' or 3' ends of reads. SAM files were converted to BAM format using samtools v1.9 and BigWig files were generated using bamCoverage v3.1.3.
Genome_build: sacCer3, EF4.74
Supplementary_files_format_and_content: Genomic coordinates of the 3' ends of mapped reads in BigWig format
|
| |
|
| Submission date |
Aug 20, 2019 |
| Last update date |
Sep 08, 2020 |
| Contact name |
Tomasz Wojciech Turowski |
| E-mail(s) |
[email protected]
|
| Organization name |
Insitute of Biochemistry and Biophysics PAS
|
| Department |
Laboratory of Transcription Mechanisms
|
| Lab |
Turowski Lab
|
| Street address |
Pawinskiego 5a
|
| City |
Warsaw |
| ZIP/Postal code |
02-106 |
| Country |
Poland |
| |
|
| Platform ID |
GPL22715 |
| Series (1) |
| GSE136056 |
Nascent Transcript Folding Plays a Major Role in Determining RNA Polymerase Elongation Rates |
|
| Relations |
| BioSample |
SAMN12608689 |
| SRA |
SRX6743653 |
