|
| Status |
Public on Apr 25, 2021 |
| Title |
PTB_10HeLaCells_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
PTB_10HeLaCells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa (ATCC CCL-2)
antibody: anti-PTB (monoclonal BB7)
|
| Growth protocol |
HeLa cells were cultured in DMEM containing 10% fetal bovine serum plus 100 U penicillin/streptomycin at 37°C in 5% CO2. Female mice at six- to eight-weeks-old were injected with 10 IU of Pregnant Mare Serum Gonadotropin (PMSG) for 48 h.Meiosis II oocytes were collected 13 hour post human chorionic gonadotropin (hCG) injection from females previously primed with PMSG.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
After UV-C irradiation, RNA cross-linked to protein is purified and ligated with an adenylated DNA linker at the 3’end. Next, cDNA fragments, which stop exactly at the cross-link site in RNA, are generated through reverse transcription (RT), followed by polyadenylation, in vitro transcription (IVT), PCR amplification and high-throughput sequencing.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
replicates were merged for processing and the generated processed data is linked to the corresponding replicate 1 sample records
PTB-10HeLa-1_AGTTC_L004
|
| Data processing |
library strategy: LACE-seq
Illumina bcl2fastq-1.8.4 conversion software used for basecalling.
After sequencing of LACE-seq libraries, the adapter sequences and the polyA tails at the 3' end were removed sequentially using Cutadapt v1.15 with the following two parameters: -f fastq -q 30,0 -a ATCTCGTATGCCGTCTTCTGCTT -m 18 --max-n 0.25 --trim-n, and -f fastq -a A{15} -m 18 -n 2.
After filtering, the LACE-seq reads were first aligned to human or mouse pre-rRNA by bowtie with default parameters, and the remaining unmapped reads were then aligned to the hg19 or mm9 reference genome. For LACE-seq data mapping, two mismatches and at most 10 multiple hits were allowed (bowtie parameters: -v 2 -m 10 --best --strata).
Small RNA-seq data were processed as previously described (Yang, Q. et al.)
Genome_build: hg19, mm9
Supplementary_files_format_and_content: Bigwig files were generated using bedtools genomecov v2.17.0 and bedGraphToBigWig v4 software. txt file contains reads id and corresponding small RNA class
|
| |
|
| Submission date |
Sep 24, 2019 |
| Last update date |
Apr 27, 2021 |
| Contact name |
Yuanchao Xue |
| E-mail(s) |
[email protected]
|
| Organization name |
Chinese Academy of Sciences
|
| Department |
Institute of Biophysics
|
| Lab |
Key Laboratory of RNA Biology
|
| Street address |
Datun Road #15
|
| City |
Beijing |
| ZIP/Postal code |
100101 |
| Country |
China |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE137925 |
Global Profiling of RNA-Binding Protein Target Sites by LACE-seq |
|
| Relations |
| BioSample |
SAMN12830165 |
| SRA |
SRX6895024 |
