|
| Status |
Public on Jan 14, 2020 |
| Title |
RNA_4_allAG_4_G418_500_B |
| Sample type |
SRA |
| |
|
| Source name |
G418 500 ug/mL RNAseq B
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T cells
treatment: G418
concentration: 500 ug/mL
duration: 24 hours
adapter: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
|
| Treatment protocol |
Aminoglycosides were added to cells, and treated for either 10 minutes or 24 hours
|
| Growth protocol |
Cells were grown in DMEM with 10% FBS to ~75% confluency before harvest
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were lysed on ice in the presence of cycloheximide. Lysates were clarified by centrifugation. For ribosome profiling, monosomes were generated by RNaseI digest followed by ultracentrifugation. For RNAseq, total RNA was extracted using Trizol, and sequencing libraries were prepared using the Illumina TruSeq Stranded Total RNA Library Prep Gold (20020598) kit.
For ribosome profiling, fragments ranging from 15-34 nt were gel purified. Upon dephosphorylation of sample RNA, linker was ligated and this product and and rRNA was depleted using Ribo-Zero Gold from Illumina. This was followed by reverse transcription and gel purification. Libraries were then circularized, PCR-amplified, and gel-purified cDNA was submitted for sequencing. RNA-seq samples were prepared from 1 ug of total RNA following the Truseq protocol.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Total RNA
|
| Data processing |
Base calling was performed at Johns Hopkins core facilities with CASAVA 1.8
Deduplication of PCR duplicates using Tally
5 prime ends of reads were trimmed using seqtk removing 4 nucleotides of degenerate RT primer sequence (RNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/TTCAGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG)
Linker sequence (NNNNNNCACTCGGGCACCAAGGAC) was trimmed using Skewer
reads aligning to non-coding RNA sequences including rRNA and tRNA were depleted using STAR
remaining reads were aligned to the human genome using STAR
Genome_build: GRCh38 (hg38), Gencode release 30
Supplementary_files_format_and_content: Count tables for ribosome profiling and RNA-seq samples
|
| |
|
| Submission date |
Oct 09, 2019 |
| Last update date |
Jan 14, 2020 |
| Contact name |
Rachel Green |
| E-mail(s) |
[email protected]
|
| Organization name |
Johns Hopkins University School of Medicine
|
| Department |
Molecular Biology and Genetics
|
| Lab |
Rachel Green
|
| Street address |
725 N Wolfe St
|
| City |
Baltimore |
| State/province |
MD |
| ZIP/Postal code |
21205 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE138638 |
Stop Codon Context Influences Genome-Wide Stimulation of Termination Codon Readthrough by Aminoglycosides [Dataset 1] |
| GSE138643 |
Stop Codon Context Influences Genome-Wide Stimulation of Termination Codon Readthrough by Aminoglycosides |
|
| Relations |
| BioSample |
SAMN13000212 |
| SRA |
SRX6969300 |
