|
| Status |
Public on Jul 15, 2020 |
| Title |
Tn-Seq CHAH C |
| Sample type |
SRA |
| |
|
| Source name |
Bacterial cells grown on CHAH, resuspended in DMEM + 10% FBS
|
| Organism |
Francisella tularensis subsp. holarctica LVS |
| Characteristics |
sample name: Sample 3
transposon library: Complex transposon mutant library
treatment: sample taken after growth on CHAH and resuspended in DMEM + 10% FBS
library pairs: Input library for sample 5
analysis groups: all in vitro critical genes, intramacrophage growth
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
gDNA extraction ws performed with Epicentre MasterPure Complete DNA and RNA Purification Kit
Libraries were prepared as in Goodman et al., 2001 (PMID: 22094732), starting with linear PCR. Custom adapters were used as per protocol.
|
| |
|
| Library strategy |
Tn-Seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Transposon-genomic DNA junctions amplified from transposon mutant library gDNA
Mac_24_input2_TnOnly_HighConfCounts.wig
AllInput2_TnOnly_HighConfCounts.wig
|
| Data processing |
Cutadapt (version 1.16; Martin, 2011) used to demultiplexed
Cutadapt (version 1.16; Martin, 2011) used trim adapters (cutadapt -a ACAGGTTGGATGATAAGTCCCCGGTCTTCGTATGCCGTCTTCTGCTTG --no-indels --discard-untrimmed )
reads mapped to genome (NC_007880.1) using bowtie (version 1.2; Langmead et al., 2009) with a seed length of 16 and zero mismatches allowed (bowtie --best -k 1 --fullref -v 0 -l 16)
Custom scripts were used to identify reads corresponding to insertions in TA sites and tally only those insertions with reads mapping from both ends of the transposon
Datasets were normalized for positional bias using Matlab
EL-ARTIST (Pritchard et al., 2014, PMID: 25375795) was used to identify genes essential for in vitro growth
CON-ARTIST (Pritchard et al., 2014, PMID: 25375795) was used to identify genes critical for survival in media and in macrophage
Genome_build: NC_007880.1
Supplementary_files_format_and_content: wig files with value representing the number of high-confidence transposon insertions at TA sites (arbitrarily placed at the T of the TA dinucleotide)
|
| |
|
| Submission date |
Oct 09, 2019 |
| Last update date |
Jul 15, 2020 |
| Contact name |
Simon L Dove |
| E-mail(s) |
[email protected]
|
| Organization name |
Boston Children's Hospital and Harvard Medical School
|
| Department |
Division of Infectious Diseases
|
| Lab |
Dove Laboratory
|
| Street address |
300 Longwood Ave
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL27588 |
| Series (1) |
| GSE138658 |
Comprehensive transposon insertion sequencing screen in Francisella tularensis LVS |
|
| Relations |
| BioSample |
SAMN13001613 |
| SRA |
SRX6971262 |
