 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 28, 2020 |
| Title |
urt1-1 xrn4-3 replicate1 |
| Sample type |
SRA |
| |
|
| Source name |
24 day-old plantlets
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
genotype: urt1-1 xrn4-3
biological replicate: replicate 1
reference sequence: TAIR10
|
| Growth protocol |
The plant material corresponds to Arabidopsis plantlets grown for 24 days in vitro on Murashige & Skoog media with 0.8 % agar and 12 hr light (22 °C)/12 hr darkness cycles (18 °C).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from seedlings with TRI Reagent® (Molecular Research Center) according to manufacturer’s instructions
Libraries were generated from 3 µg of DNase treated-RNA using the Illumina TruSeq® Small RNA protocol after size selection of 18-30 nt RNA fragments on a denaturing polyacrylamide gel.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Processed_data_SMALL.txt
|
| Data processing |
The base calls were acquired from HiSeq 2500 after processing by Illumina RTA 1.18.61.0 and CASAVA pipeline v.1.8.2.
Sequencing quality was assessed with a PhiX reference spiked in the flow-cell that gave an average sequencing error rate of 0.16 % with 92 % of the reference nucleotides having a Q-score >=30 (Phred calculation).
‘TGGAATTCTCGGGTGCCAAG’ sequence corresponding to the 20 nt sequence of the 5' end of the 3’ adapter was searched and removed using in-house Fasteris pipeline.
Trimmed reads of 14 nt to 30nt in length were selected to be mapped to TAIR10 genome using bowtie (v1.0.0) (Langmead et al., 2009, https://doi.org/10.1186/gb-2009-10-3-r25) by permitting up to 1 mismatch. (http://www.arabidopsis.org).
Reads that could map to more than 50 loci were discarded and only the best alignment(s) of each small RNA sequence was kept.
BEDTools suite (v2.17.0, Quinlan and Hall, 2010, https://doi.org/10.1093/bioinformatics/btq033) was then used to annotate and count reads that map to mRNAs using intersectBed and multiBamCov tools, respectively, with default settings. mRNAs were annotated based on TAIR10 annotation (http://www.arabidopsis.org).
Normalized number of reads (Counts per Million) were calculated using the edgeR package (3.26.5).
Genome_build: TAIR10
Supplementary_files_format_and_content: One processed data file is given. It includes the processed data for the two biological replicate of each genotype.
Supplementary_files_format_and_content: Each line corresponds to one mRNA loci and indicates the gene AGI (AGI), the chromosome number (Chr), the gene start coordinate (Start), the gene end coordinate (End), the DNA stand (Strand) and the raw count and CPM for each genotype.
Supplementary_files_format_and_content: Only loci detected with at least 1 read per million for at least 2 samples are shown.
|
| |
|
| Submission date |
Apr 09, 2020 |
| Last update date |
May 28, 2020 |
| Contact name |
Dominique Gagliardi |
| E-mail(s) |
[email protected]
|
| Organization name |
CNRS
|
| Department |
IBMP
|
| Street address |
12, rue du General Zimmer
|
| City |
Strasbourg |
| ZIP/Postal code |
67084 |
| Country |
France |
| |
|
| Platform ID |
GPL17639 |
| Series (2) |
| GSE148427 |
URT1-mediated uridylation prevents the production of spurious siRNAs targeting mRNAs in Arabidopsis thaliana |
| GSE148449 |
Molecular connection between the TUTase URT1 and decapping activators |
|
| Relations |
| BioSample |
SAMN14569826 |
| SRA |
SRX8092744 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
