GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4524414

Query DataSets for GSM4524414

Status

Public on Jun 19, 2020

Title

Brain_M5w_1

Sample type

SRA

Source name

N. furzeri brain

Organism

Nothobranchius furzeri

Characteristics

tissue: brain
strain: MZM-0410
age group: 5 wph

Growth protocol

Animal maintenance was performed as described (Baumgart et al., Aging Cell 2014). To avoid effects of circadian rhythms and feeding, animals were always sacrificed at 10 a.m. in fasted state. For tissue preparation, fish were euthanized with MS-222 and cooled on crushed ice. The protocols of animal maintenance and experimentation were approved by the local authority in the State of Thuringia, Germany.

Extracted molecule

total RNA

Extraction protocol

RNA was extracted with standard Trizol protocol (Chomczynski 1995), using Qiazol lysis reagent (Qiagen).In brief 0.2mL of Chloroform were added per each mL of Trizol reagent, samples were mixed and centrifuged at 20000g for 20 minutes at 4°C in a tabletop centrifuge. After the centrifugation, the upper aqueous phase was withdrawn and mixed with 0.5 volumes of isopropyl alcohol, 0.16 volumes of Sodium acetate and 1µL of GlycoBlue to precipitate RNA. Samples were then centrifuged at 20000g for 30 minutes at 4°C, washed twice with 80% ethanol and centrifuged at 7500g for 5 minutes at 4°C. The resulting pellet was dried for no more than 5 minutes and dissolved in nuclease-free water
Small RNA library preparation was done using Illumina’s TruSeq small RNA library preparation kit following the manufacturer’s instructions.

Library strategy

miRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina HiSeq 2500

Description

small RNA-deq

Data processing

Sequence information was extracted in FastQ format using Illumina's bcl2fastq software v1.8.3.
The processing and annotation of small RNA-Seq raw data was performed using the R programming language (version 3.0.2) and the ShortRead Bioconductor package (Morgan et al., 2009). First, raw data were pre-processed with the following parameters: Quality filtering, eliminating all reads containing an “N”; Adapter trimming, by use of the function trimLRPatterns(), allowing up to 2 mismatches and using as adapter sequence "TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC".
Size filtering removed all the reads with length shorter 18 and longer 33 nucleotides.
Reads were aligned, resulting in a direct annotation and quantification. The alignment was divided in two steps, to allow the recognition and the annotation of the reads exceeding reference length. In fact, the algorithm of Bowtie 1.1.2 does not allow aligning longer reads to shorter references. Specifically, first we performed alignment against the reference (mature miRNAs, N. furzeri reference catalouge, Baumgart et al. 2017, PMID: 28874118) with up to 2 mismatches. In this step the reference used was the mature sequence of microRNAs. Each read was aligned using these criteria with Bowtie (settings: “-q", "--threads 8 --best", "—norc”). The remaining reads, which could not align in the previous step, were used as reference for a second alignment step with Bowtie 1.1.2 (settings: -f", "-a", "--threads 8 --norc"). In this case, the annotated mature microRNAs were aligned against the reads.
The information obtained in the two alignment phases was conveyed in one single table, containing a list of all the retrieved sequences and their relative counts.
Genome_build: nfurzeri_genebuild_v1
Supplementary_files_format_and_content: Counts.csv

Submission date

May 08, 2020

Last update date

Jun 19, 2020

Contact name

Marco Groth

E-mail(s)

[email protected]

Organization name

Leibniz Institute on Aging - FLI

Department

Core Facility - Next Generation Sequencing