 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 10, 2021 |
| Title |
MS2-PinT_SPI-2 |
| Sample type |
SRA |
| |
|
| Source name |
Salmonella Typhimurium SL1344 cells
|
| Organism |
Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Characteristics |
condition: SPI-2
salmonella genetic background: Salmonella Typhimurium SL1344 MS2-PinT
ms2/pint expression: MS2-PinT expressed from the native pinT locus in the chromosome
|
| Treatment protocol |
Cells were centrifuged at 10000 g for 10 minutes and the pellets frozen in liquid nitrogen. After thawing on ice, the pellets were resuspended in 600 μl of chilled Buffer A (20 mM Tris pH8.0, 150 mM KCL, 1 mM of MgCl2, 1 mM DTT). A volume of 750 μl of glass beads was added to the cells and lysed using Retsch (10 min, 30 Hz) (adaptors were pre-chilled at -20°C). Next, lysate was cleared by centrifugation 10 min at 16000g at 4°C and the clear lysate was collected into a new tube. The in-vitro infections of iBMMs (M.O.I 50) was carried out following a previously published protocol (Westermann et al., 2016) with slight modifications. Briefly, two days before infection 2 × 105 iBMMs /mL were seeded in 10 ml complete DMEM (T75 flask). A total of 4 flaks of each cell type were infected with each Salmonella strain. Overnight cultures of Salmonella carrying either PinT (pYC55), MS2-PinT (pSS31) or MS2 (pSS32), were diluted 1:100 in fresh LB medium and grown aerobically to an OD600nm of 2. Bacterial cells were harvested by centrifugation (2 min at 12,000 r.p.m., room temperature) and resuspended in DMEM. In iBMMs infection, bacterial cells were opsonized with 10% mouse serum for 20 min, prior to addition to the cells. After 4h of infection, the mammalian cells where washed with ice cold PBS and lysed with a solution of PBS 0.1% Triton. The bacterial cells where separated from the host cells debris by centrifugation at 500g for 5 min. After, the supernatant containing the bacteria was centrifuged again at 10 000 g for 5 min, washed with PBS and frozen. After elution, the purified RNA was sequenced and mapped to the either the Mouse genome and to the Salmonella genome. While the lysate is being prepared, affinity purification columns were prepared at the 4°C room. ~70 μl of amylose (New England Biolabs #E8021S) were added to 2mL Bio-Spin disposable chromatography columns (BioRad #732-6008). Amylose beads were washed three times with 2ml of Buffer A. 1ml of Buffer A with 250 pmol of MS2-MBP coat protein was added to the closed column followed incubation with rotation. After 5 minutes, the column was open and the MS2-coat protein was to run through the column and collected in a tube. This incubation step was repeated one more time until the lysate was ready. At this point, the solution was allowed to run and the column was washed once with 1ml of Buffer A. The clear lysate was subjected to affinity chromatography (all the following steps were performed at 4 °C). Lysate was added to the closed column and incubated for 5 minutes with rotation. After the incubation, the lysate run was collected and the incubation step was repeated. Next, the column is washed 8 times with 2ml of Buffer A. Bound RNA was eluted using 300μl of Elution Buffer (Buffer A + 15 mM maltose). This step was repeated one more time.
|
| Growth protocol |
Salmonella Thyphimurium strain SL1344 was grown from single colonies in SPI-1, SPI-2 conditions. For SPI-1 cells were grown to OD600nm of 2.0, overexpression of the different constructs was induced by the addition of 0.1% arabinose. After two minutes, a volume of 60OD of cell was harvested and chilled on ice for 5 minutes. To grow Salmonella under SPI-2-inducing conditions, 1 ml of Salmonella grown in LB to OD600nm2 was washed 2x in PBS and 1x in synthetic SPI-2 medium (Löber et al., 2006). The resulting pellet was resuspended in 1 mL of SPI-2 medium and diluted 1:50 in fresh, pre-warmed SPI-2 medium (10 mL total culture volume) in 100 mL Erlenmeyer flasks. The culture was grown at 37°C, 220 rpm until it reached an OD600nm of 0.3 (takes approximately 3 h).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Eluted RNA was extracted with phenol-chloroform (V/V) and precipitated by the addition of ethanol (2 vol) and ~15μg of glycogen (1μl of Glycoblue 15mg/ml). RNA samples were treated with DNase I (Fermentas) for 45 min at 37°C. DNase I was then removed using phenol- chloroform extraction and RNA was again precipitated.
The RNA samples were first fragmented using ultrasound (4 pulses of 30 s each at 4°C). Then, an oligonucleotide adapter was ligated to the 3' end of the RNA molecules. First-strand cDNA synthesis was performed using M-MLV reverse transcriptase and the 3’ adapter as primer. The first-strand cDNA was purified and the 5' Illumina TruSeq sequencing adapter was ligated to the 3' end of the antisense cDNA. The resulting cDNA was PCR-amplified to about 10-20 ng/μl using a high fidelity DNA polymerase (11 cycles). The TruSeq barcode sequences which are part of the 5' TruSeq sequencing adapter are included in Table 2. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and was analyzed by capillary electrophoresis. For Illumina NextSeq sequencing, the samples were pooled in approximately equimolar amounts. The cDNA pool in the size range of 200-550 bp was eluted from a preparative agarose gel. The cDNA pool was paired- end sequenced on an Illumina NextSeq 500 system using 2x50 bp read length.
library strategy: MAPS
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
MS2-affinity-purified RNA
signal sample
|
| Data processing |
Base calling with Illumina NextSeq RTA v2.4.11 (SPI-2 and in vivo, SPI-1 unknown)
FASTQ conversion with bcl2fastq v2.20.0.422 (SPI-2 and in vivo, SPI-1 unknown)
FASTQ quality and adapter trimming using Cutadapt (Martin, 2011). SPI-1: version 1.10/1.12 with parameters -q 20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; SPI-2/in vivo: version 1.16/2.5 with parameters --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
SPI-1/2: read alignment to Salmonella Typhimurium SL1344 genome and MS2-PinT, MS2 and PinT constructs using segemehl version 0.2.0 (parameters for reademption align: -l 12 -P -a 95) (READemption 0.4.3, Förstner et al., 2014); in vivo: read alignment to Salmonella Typhimurium SL1344 and mouse genome as well as MS2-PinT, MS2 and PinT constructs using segemehl version 0.2.0 (parameters for reademption align: -r -l 20 -P -a 90 -S) (READemption 0.4.5, Förstner et al., 2014)
Read quantification via reademption gene_quanti using Salmonella annotations (parameters: -o 1 -t "5UTR,CDS,3UTR,rRNA,tRNA,sRNA,transcript" -a) (READemption 0.4.3/0.4.5, Förstner et al., 2014)
Size factor calculation based on rRNA read counts only via DESeq2 (Love et al., 2014)
Coverage calculation via reademption coverage based on all aligned reads (full-length) (READemption 0.4.5, Förstner et al., 2014)
Extraction of Salmonella raw coverage values (in vivo only) and coverage normalization by rRNA-based size factors
Genome_build: Salmonella Typhimurium SL1344 (GCF_000210855.2) and mouse (GRCm38.p6)
Supplementary_files_format_and_content: wiggle files containing positional read coverage values
|
| |
|
| Submission date |
Sep 04, 2020 |
| Last update date |
Feb 11, 2021 |
| Contact name |
Tom Gräfenhan |
| E-mail(s) |
[email protected]
|
| Phone |
+49 - 931 - 31 - 80814
|
| Organization name |
University of Wuerzburg
|
| Department |
Core Unit SysMed
|
| Lab |
Raum D15.02.045
|
| Street address |
Josef-Schneider-Str. 2, Bau D15
|
| City |
Würzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL20056 |
| Series (1) |
| GSE157499 |
MAPS integrates regulation of actin-targeting effector SteC into the virulence control network of Salmonella small RNA PinT |
|
| Relations |
| BioSample |
SAMN16058911 |
| SRA |
SRX9075682 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4767232_MS2-PinT_SPI-2_forward.wig.gz |
5.3 Mb |
(ftp)(http) |
WIG |
| GSM4767232_MS2-PinT_SPI-2_reverse.wig.gz |
5.6 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
