 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 29, 2021 |
| Title |
Anti_H2AK119ub_BaF3_WT |
| Sample type |
SRA |
| |
|
| Source name |
WT Ba/F3 cell line
|
| Organism |
Mus musculus |
| Characteristics |
cell line: Ba/F3
chip antibody: anti-H2AK119Ub (Cell Signaling Technology, D27C4)
|
| Treatment protocol |
For CRISPR-Cas9 edited samples: Plasmid pSpCas9(BB)-2A-GFP (PX458) was obtained from Addgene (#48138). gRNAs targeting Bap1 were designed using the Zhang lab software (http://crispr.mit.edu): gRNA_Bap1_Exon4_ Chr14:32,066,155: gcaaatggatcgaagagcgc and gRNA_Bap1_Exon5_Chr14:32,066,654: ggcgtgagtggcacaagagt. The gRNAs were ligated into the BbsI (NEB) digested PX458 plasmid, and the resulting plasmids were transformed into DH5α competent cells, purified using PureLink HiPure Plasmid Filter Midiprep Kit (Invitrogen), and verified by Sanger sequencing. To introduce the constructed plasmid into Ba/F3 cells, nucleofection was performed using Amaxa Cell Line Nucleofector Kit V (Lonza) according to the manufacturer’s protocols. Single GFP+ cells were sorted 48 hours after the nucleofection and then expanded over two weeks to generate single cell clones. The loss of BAP1 protein expression in the cell line clones was validated via Western blotting, with the following antibodies: anti-BAP1 (D7W7O, Cell Signaling Technology), anti-β-Actin (D6A8, Cell Signaling Technology), HRP-conjugated anti-mouse-Ig (eB144, Rockland), and HRP-conjugated anti-rabbit-Ig (eB182, Rockland).
|
| Growth protocol |
Murine B cell lineage precursor cell line Ba/F3 was maintained at 0.5-2 x10^6 cells/mL in RPMI-1640 (Wisent) with 10% Fetal Calf Serum (FCS, Wisent), 2mM L-Glutamine, 100μg/mL streptomycin, 100U/mL penicillin (Wisent), and 5% WEHI conditioned media as the source of IL-3. Ba/F3 cell lines stably expressing triple-FLAG-tagged murine BAP1 and CRISPR-Cas9 targeted Bap1 knockout cell lines were maintained under 2μg/mL puromycin selection (Wisent).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were crosslinked for 10 min at room temperature with 1% formaldehyde added in culture medium. Crosslink was stopped with ice-cold PBS containing 0.125M glycine for 5min. Nuclei were prepared by sequential incubation on ice for 5min in buffer A [10mM Tris-HCl (pH 8), 10mM EDTA, 0.25% Triton X-100], and for 30min in buffer B [10mM Tris-HCl (pH 8), 1mM EDTA, 200mM NaCl] (all buffers include proteases inhibitors). Nuclei were resuspended in sonication buffer [10mM Tris-HCl (pH 8), 1mM EDTA, 0.5% SDS, 0.5% Triton X-100, 0.05% NaDOC, 140mM NaCl] and sonicated with a Branson Digital Sonifier (Branson Ultrasonics) to an average size of 250bp (12 cycles of 30 seconds at 80%, with 30 seconds rest in cooled circulating water). Sonicated chromatin from the equivalent of 5x10^6 cells per ChIP was incubated overnight on a rotating platform at 4°C with 40μL of Dynabeads Protein G (Invitrogen, Life Technologies) conjugated with antibodies: anti-BAP1 (Cell Signaling Technology, D1W9B, 52.8 μg), anti-FLAG M2 (Sigma, F1804, 5 μg) or anti-H2AK119Ub (Cell Signaling Technology, D27C4, 5 μg). Immune complexes with anti-BAP1 and anti-H2AK119Ub antibodies were washed sequentially for 2min at room temperature with 1ml of the following buffers: Wash 1 [0.5% NP-40, 150mM KCl, 1mM EDTA, 10mM Tris-HCl pH8]; Wash 2 [0.5% Triton, 0.1% NaDOC, 100mM NaCl, 10mM Tris-HCl pH8]; Wash 3A [0.5% Triton, 0.1% NaDOC, 400mM NaCl, 10mM Tris-HCl pH8]; Wash 3B [0.5% Triton, 0.1% NaDOC, 500mM NaCl, 10mM Tris-HCl pH8]; and Wash 4 [0.5% NaDOC, 0.5% NP-40, 250mM LiCl, 1mM EDTA, 10mM Tris-HCl pH8]. Immune complexes with anti-FLAG antibody was washed sequentially for 2min at room temperature with 1ml of the following buffers: Wash B [1% Triton X-100, 0.1% SDS, 150mM NaCl, 2mM EDTA, 20mM Tris-HCl pH 8]; Wash C [1% Triton X-100, 0.1% SDS, 500mM NaCl, 2mM EDTA, 20mM Tris-HCl pH 8]; Wash D [1% NP-40, 250mM LiCl, 1mM EDTA, 10mM Tris-HCl pH 8]; and TEN buffer [50mM NaCl, 10mM Tris-HCl pH 8, 1mM EDTA]. After de-crosslinking by overnight incubation at 65°C, the ChIP and Input DNA was purified with Qiaquick PCR Cleanup kit following manufacturer’s instructions (Qiagen).
ChIP-seq libraries were prepared using the Illumina TruSeq kit and sequenced on an Illumina HiSeq 4000 sequencer in paired-end 50bp configuration, with input DNA from the same cells sequenced as negative control.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Reads quality filtered according to the Illumina pipeline
Experimental and input control sequence reads were mapped to the mouse mm9 reference genome assembly with Bowtie 1.0.0 using the following settings: --best mm9.
Chromatin binding sites of BAP1 were identified using peak detection algorithm MACS (version 1.4.2, default parameters), with comparisons for read enrichment against control input DNA from the same cells.
The resulting binding sites were filtered to remove regions with < 5 fold enrichment compared to the input DNA and < 5 normalized tag counts within 200bp to the peak summit.
Genome_build: mm9
|
| |
|
| Submission date |
Nov 24, 2020 |
| Last update date |
Mar 29, 2021 |
| Contact name |
Anastasia Nijnik |
| E-mail(s) |
[email protected]
|
| Phone |
514-398-5567
|
| Organization name |
McGill University
|
| Department |
Physiology
|
| Lab |
Nijnik Lab
|
| Street address |
Rm 368 - 3649 Promenade Sir William Osler
|
| City |
Montreal |
| State/province |
Quebec |
| ZIP/Postal code |
H3G 0B1 |
| Country |
Canada |
| |
|
| Platform ID |
GPL21103 |
| Series (2) |
| GSE162083 |
Regulation of B lymphocyte development by histone H2A deubiquitinase BAP1 (BAP1_ChIP-Seq) |
| GSE162085 |
Regulation of B lymphocyte development by histone H2A deubiquitinase BAP1 |
|
| Relations |
| BioSample |
SAMN16881973 |
| SRA |
SRX9567702 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4932845_Anti_H2AK119ub_BaF3_WT_paired_bowtie_res1_norm1e7.bw |
553.1 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
