|
Status |
Public on May 13, 2010 |
Title |
K562 |
Sample type |
SRA |
|
|
Source name |
Chronic Myelogenous Leukemia cell line
|
Organism |
Homo sapiens |
Characteristics |
cell type: Chronic Myelogenous Leukemia cell line cell line: K562
|
Growth protocol |
Cells were grown in RPMI medium with 10% fetal bovine serum in 5% CO2 and passaged after every 2 days.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA isolation was carried out from peripheral blood and cell lines using TRIzol® Reagent (Invitrogen) as per manufacturer’s instruction. RNA preparations were stored at -80C till further use. Small RNA (sRNA) population was isolated by separating 10 µg of total RNA on denaturing polyacrylamide gel electrophoresis (PAGE) and cutting a portion of the gel corresponding to the size 18-30 nucleotides based standard oligonucleotide markers. Adapter (5’) was ligated to sRNA population and ligated RNAs (40-60 nt) were purified by running on urea PAGE. This was followed by 3’ adapter ligation and purification of adapter ligated RNAs (70-90 nt) in a similar manner. Modified sRNAs were reverse transcribed and then PCR amplified with adapter specific primers and the amplified cDNAs were finally purified on Urea PAGE to generate cDNA tag libraries for sequencing by illumina genome analyzer. The average number of sequencing reads was around 4.9 million.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer |
|
|
Description |
K562 cell line is derived from a CML patient in terminal blast crisis and used as model for CML studies
|
Data processing |
The raw sequence files, the untrimmed tag files and the trimmed tag files were provided by Illumina Inc, USA using the Illumina analysis pipeline.
Untrimmed tag files : Each file contains sequences (column2) with parts of the adaptor sequence:"TCGTATGCCGTCTTCTGCTTG" and their corresponding frequency (column1). The amount of the adaptor is variable and is dependent on the length of the sRNA.
Unique trimmed (adaptor sequence removed) sequence reads with their respective counts / frequency: Each file contains unique trimmed sequences (column1) with their corresponding frequency (column2). These sequences were generated by removal of the adaptor sequence. After the removal of the adaptor sequences the redundancy is removed to get a trimmed unique non-redundant file. The numerical frequency of each sequence in these files gives a true indication of relative expression of the sequence transcripts. It also gives the researcher an indication of most common to most rare sequences in the dataset.
miRNA expression profile for the 4 samples: The trimmed files were then matched (using BLASTN) with the known Homo sapiens mature miRNAs from miRNA registry release 12 (866 mature miRNAs) to generate the expression profile.For making the samples comparable among each other, each transcript/sequence (representing a known miRNA) frequency was divided by the total transcripts present in the corresponding sample and multiplied by 1000000.The total transcript is the sum of the frequencies of all the unique sequences / transcripts present in the trimmed file.This file contains a list of the known miRNAs found in all the 4 samples along with their respective frequencies and (Transcripts parts per million) TPM values.
|
|
|
Submission date |
Jan 08, 2010 |
Last update date |
May 15, 2019 |
Contact name |
Alok Bhattacharya |
E-mail(s) |
[email protected], [email protected]
|
Organization name |
Jawaharlal Nehru University
|
Department |
School of Life Sciences
|
Lab |
#118
|
Street address |
New Mehrauli Road
|
City |
New Delhi |
State/province |
New Delhi |
ZIP/Postal code |
110067 |
Country |
India |
|
|
Platform ID |
GPL9052 |
Series (2) |
GSE19812 |
Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood (seq data) |
GSE19833 |
Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood |
|
Relations |
SRA |
SRX018696 |
BioSample |
SAMN00010841 |