|
Status |
Public on Apr 25, 2021 |
Title |
Ago2.50_oocytes.withoutIVT.rep1 |
Sample type |
SRA |
|
|
Source name |
Mouse Oocytes
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6 genotype/variation: Wild type Sex: Female cell type: MII oocytes treatment: No treatment antibody: anti-Ago2 (Abcam, ab186733)
|
Treatment protocol |
Female mice at six- to eight-weeks-old were injected with 10 IU of Pregnant Mare Serum Gonadotropin (PMSG) for 48 h. Meiosis II oocytes were collected 13 hour post human chorionic gonadotropin (hCG) injection from females previously primed with PMSG.
|
Growth protocol |
HeLa cells were cultured in DMEM containing 10% fetal bovine serum plus 100 U penicillin/streptomycin at 37°C in 5% CO2. K562 cells were cultured in RPMI-1640 containing 10% fetal bovine serum plus 100 U penicillin/streptomycin at 37°C in 5% CO2.
|
Extracted molecule |
total RNA |
Extraction protocol |
After UV-C irradiation, RNA cross-linked to protein is purified and ligated with an adenylated DNA linker at the 3’end. Next, cDNA fragments, which stop exactly at the cross-link site in RNA, are generated through reverse transcription (RT), followed by polyadenylation, in vitro transcription (IVT), PCR amplification and high-throughput sequencing.
|
|
|
Library strategy |
RIP-Seq |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
LACE-seq Ago2.50_oocytes.withoutIVT.bigwig
|
Data processing |
Illumina bcl2fastq-1.8.4 conversion software used for basecalling. After sequencing of LACE-seq libraries, the adapter sequences and the polyA tails at the 3' end were removed sequentially using Cutadapt v1.15 with the following two parameters: -f fastq -q 30,0 -a ATCTCGTATGCCGTCTTCTGCTT -m 18 --max-n 0.25 --trim-n, and -f fastq -a A{15} -m 18 -n 2. After filtering, the LACE-seq reads were first aligned to human or mouse pre-rRNA by bowtie with default parameters, and the remaining unmapped reads were then aligned to the hg19 or mm9 reference genome. For LACE-seq data mapping, two mismatches and at most 10 multiple hits were allowed (bowtie parameters: -v 2 -m 10 --best --strata). Genome_build: hg19 (GRCh37), mm9 (MGSCv37) Supplementary_files_format_and_content: BigWig files were generated using bedtools genomecov v2.28.0 and bedGraphToBigWig v4 software.
|
|
|
Submission date |
Jan 14, 2021 |
Last update date |
Apr 25, 2021 |
Contact name |
Yuanchao Xue |
E-mail(s) |
[email protected]
|
Organization name |
Chinese Academy of Sciences
|
Department |
Institute of Biophysics
|
Lab |
Key Laboratory of RNA Biology
|
Street address |
Datun Road #15
|
City |
Beijing |
ZIP/Postal code |
100101 |
Country |
China |
|
|
Platform ID |
GPL19057 |
Series (1) |
GSE137925 |
Global Profiling of RNA-Binding Protein Target Sites by LACE-seq |
|
Relations |
BioSample |
SAMN17316621 |
SRA |
SRX9852075 |