NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5028050 Query DataSets for GSM5028050
Status Public on Sep 16, 2021
Title Human Donor Lung 76
Sample type SRA
 
Source name Lung
Organism Homo sapiens
Characteristics age: 67
tissue: distal lung
Extracted molecule total RNA
Extraction protocol Snap-frozen lungs were homogenized in Qiazol reagent. RNA was extracted using the miRNeasy Mini Kit (Qiagen).
First the mRNA was randomly fragmented; after cDNA first strand synthesis, second strand was generated by nick-translation, followed by purification, terminal repair, Atailing, ligation of sequencing adapters, size selection and PCR enrichment.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Description N1861
Data processing Raw reads were aligned and gene counts generated with STAR v2.7.1a to the HG38 human genome and the Ensembl gene build v95 with the following parameters: --outSAMtype BAM Unsorted --outFilterType BySJout --outFilterMultimapNmax 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.04 --clip3pAdapterSeq GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJDBoverhangMin 1 --quantMode GeneCounts
Individual sample counts matrix were merged using custom python scripts and used as input to DESeq2 1.24.0
Supplementary_files_format_and_content: Matrix table with raw gene counts for every gene and every sample
Supplementary_files_format_and_content: Matrix table with DESeq2 normalized gene counts for every gene and every sample
 
Submission date Jan 20, 2021
Last update date Sep 16, 2021
Contact name Seoyeon Lee
E-mail(s) [email protected]
Phone 4155021465
Organization name University of California, San Francisco
Department Pulmonary and Critical Care Medicine
Street address 513 Parnassus Ave HSE 1355B
City San Francisco
State/province CA
ZIP/Postal code 94143
Country USA
 
Platform ID GPL24676
Series (1)
GSE165192 Bulk RNA Sequencing of 86 Human Donor Lungs
Relations
BioSample SAMN17390292

Supplementary data files not provided
Processed data are available on Series record
Raw data not provided for this record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap