|
Status |
Public on Sep 16, 2021 |
Title |
Human Donor Lung 78 |
Sample type |
SRA |
|
|
Source name |
Lung
|
Organism |
Homo sapiens |
Characteristics |
age: 68 tissue: distal lung
|
Extracted molecule |
total RNA |
Extraction protocol |
Snap-frozen lungs were homogenized in Qiazol reagent. RNA was extracted using the miRNeasy Mini Kit (Qiagen). First the mRNA was randomly fragmented; after cDNA first strand synthesis, second strand was generated by nick-translation, followed by purification, terminal repair, Atailing, ligation of sequencing adapters, size selection and PCR enrichment.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Description |
N1865
|
Data processing |
Raw reads were aligned and gene counts generated with STAR v2.7.1a to the HG38 human genome and the Ensembl gene build v95 with the following parameters: --outSAMtype BAM Unsorted --outFilterType BySJout --outFilterMultimapNmax 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.04 --clip3pAdapterSeq GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJDBoverhangMin 1 --quantMode GeneCounts Individual sample counts matrix were merged using custom python scripts and used as input to DESeq2 1.24.0 Supplementary_files_format_and_content: Matrix table with raw gene counts for every gene and every sample Supplementary_files_format_and_content: Matrix table with DESeq2 normalized gene counts for every gene and every sample
|
|
|
Submission date |
Jan 20, 2021 |
Last update date |
Sep 16, 2021 |
Contact name |
Seoyeon Lee |
E-mail(s) |
[email protected]
|
Phone |
4155021465
|
Organization name |
University of California, San Francisco
|
Department |
Pulmonary and Critical Care Medicine
|
Street address |
513 Parnassus Ave HSE 1355B
|
City |
San Francisco |
State/province |
CA |
ZIP/Postal code |
94143 |
Country |
USA |
|
|
Platform ID |
GPL24676 |
Series (1) |
GSE165192 |
Bulk RNA Sequencing of 86 Human Donor Lungs |
|
Relations |
BioSample |
SAMN17390290 |