|
| Status |
Public on Sep 16, 2021 |
| Title |
Human Donor Lung 82 |
| Sample type |
SRA |
| |
|
| Source name |
Lung
|
| Organism |
Homo sapiens |
| Characteristics |
age: 72
tissue: distal lung
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Snap-frozen lungs were homogenized in Qiazol reagent. RNA was extracted using the miRNeasy Mini Kit (Qiagen).
First the mRNA was randomly fragmented; after cDNA first strand synthesis, second strand was generated by nick-translation, followed by purification, terminal repair, Atailing, ligation of sequencing adapters, size selection and PCR enrichment.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
N1329
|
| Data processing |
Raw reads were aligned and gene counts generated with STAR v2.7.1a to the HG38 human genome and the Ensembl gene build v95 with the following parameters: --outSAMtype BAM Unsorted --outFilterType BySJout --outFilterMultimapNmax 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.04 --clip3pAdapterSeq GATCGGAAGAGCACACGTCTGAACTCCAGTCAC --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJDBoverhangMin 1 --quantMode GeneCounts
Individual sample counts matrix were merged using custom python scripts and used as input to DESeq2 1.24.0
Supplementary_files_format_and_content: Matrix table with raw gene counts for every gene and every sample
Supplementary_files_format_and_content: Matrix table with DESeq2 normalized gene counts for every gene and every sample
|
| |
|
| Submission date |
Jan 20, 2021 |
| Last update date |
Sep 16, 2021 |
| Contact name |
Seoyeon Lee |
| E-mail(s) |
[email protected]
|
| Phone |
4155021465
|
| Organization name |
University of California, San Francisco
|
| Department |
Pulmonary and Critical Care Medicine
|
| Street address |
513 Parnassus Ave HSE 1355B
|
| City |
San Francisco |
| State/province |
CA |
| ZIP/Postal code |
94143 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (1) |
| GSE165192 |
Bulk RNA Sequencing of 86 Human Donor Lungs |
|
| Relations |
| BioSample |
SAMN17390286 |
