 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 07, 2021 |
| Title |
frog_oocyte_PABPC1_TAIL_seq |
| Sample type |
SRA |
| |
|
| Source name |
Xenopus laevis stage VI oocyte
|
| Organism |
Xenopus laevis |
| Characteristics |
cell type: oocyte
Stage: VI
manipulation: PABPC1-overexpressed
time after 5eu labeling (h): N/A
time after iaa addition (h): N/A
rna population: cytoplasmic RNA
library type: TAIL-seq
|
| Treatment protocol |
For 5EU labeling: 48 h after siRNA transfection, HeLa cells were incubated with pre-warmed fresh media with 400 µM 5-ethynyl uridine (5EU, Jena Biosciences) for 1, 2, 4, and 8 h. For IAA-indcued degradation, HCT116 cells were incubated with 1 µg/ml doxycycline and 0.2 mM auxinole (Aobious, AOB8812), an inhibitor of OsTIR1 for 6 h, after which fresh media with 1 µg/ml doxycycline and 0.5 mM IAA were added. Cells were collected after 0.5, 1, and 3 h of induction.
|
| Growth protocol |
All mammalian cells were cultured at 37°C with 5% CO2. HeLa cells were cultured in DMEM (VWR, 45000-304) with 10% FBS (TaKaRa, 631106). HCT116 OsTIR1 cells were cultured in McCoy’s 5A media (Thermo Fisher, 16600082) supplemented with 10% FBS, 2mM L-glutamine (Thermo Fisher, 25030081). NIH3T3 cells were cultured in DMEM with 10% BCS (Sigma, 12133C).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
To prepare lysate from mammalian cells, cycloheximide (CHX) was added to each plate at final concentration 100 µg/ml. Plates were immediately moved to a cold room and culture media were removed. Cells were washed twice with ice-cold PBS supplemented with 100 µg/ml CHX. After the last wash, 1 ml buffer RLL (20 mM HEPES pH 7.5, 100 mM KCl, 5 mM MgCl2, 1% (v/v) Triton X-100, 100 µg/ml cycloheximide, 500 unit/ml RNasin Plus (Promega, N2615), 2 mM DTT, cOmplete protease inhibitor cocktail (Sigma, 11836170001, 1 tablet per 10ml buffer)) was added to each 15 cm plate, and cells were scraped off and incubated on ice for 10 min. The resulting lysates were passed through a 26-gauge needle six times and cleared by centrifugation at 1300g at 4°C for 10 min. To prepare lysate from frog oocytes, injected oocytes were washed once with complete OR-2 buffer and three times with buffer RLL. After removing all wash buffer, oocytes were lysed in buffer RLL (10 µl/oocyte) by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5,000g at 4°C for 10 min. One tenth of each cleared lysate was added to 10 volumes of Tri Reagent for total-RNA preparation, following the manufacturer’s protocol. Another small portion (~10 µl) was taken for western analysis. The remainder was aliquoted, flash frozen in liquid nitrogen, and stored at –80°C.
Sequencing libraries were prepared as described previously (Subtelny et al., 2014) and (Eisen et.al, 2020)
Library strategies were as described previously (Subtelny et al., 2014) and (Eisen et.al, 2020)
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
C03
no rRNA depletion
|
| Data processing |
Library strategy: TAIL-seq
Illumina 1.5; Conventional base calls
Read trimming: Cutadapt (v1.18). For ribo-seq and ribo-seq matched RNA-seq: cutadapt -m 15 -u 4 --match-read-wildcards -e 0.1 -a TCGTATGCCGTCTTCTGCTTG -O 1; For PAL-seq: cutadapt -m 15 -u 12 --match-read-wildcards -e 0.05 -a NNNNATCTCGTATGCCGTCTTCTGCTTG -O 7
Read mapping: STAR (v2.4.2a): STAR --runThreadN 23 --runMode alignReads --outFilterMultimapNmax 1 --outFilterType BySJout --outSAMattributes All --outSAMtype BAM SortedByCoordinate
Transcript modle: human (release 25, GRCh38.p7, main annotation) and mouse (release 10, GRCh38.p4, primary assembly) gene annotations were downloaded from the GENCODE website. X. laevis gene annotations (v9.1 assembly, v1.8.3.2 primary transcript) were downloaded from the Xenbase website, and only chromosomal annotations were used. X. laevis mitochondrial gene annotations were curated based on the information obtained from the NCBI website (NC_001573.1) and appended. For all species, annotations for protein-coding genes were extracted, and for each gene, the isoform with the longest open reading frame (ORF) was selected to represent that gene. In cases in which multiple isoforms had ORFs of the same length, the isoform with the longest transcript was selected as the reference annotation.
Assigning reads to genes: htseq-count (0.11.0) and bedtools (v2.26.0). For ribo-seq and ribo-seq matched RNA-seq: htseq-count -f bam -t CDS; for NEXTflex RNA-seq: htseq-count -s reverse -f bam -t exon; for TAIL-seq: intersect -wa -wb -bed -s; for PAL-seq: intersect -wa -wb -bed -S
Genome_build: Human (GRCh38.p7), Mouse (GRCh38.p4), Frog (Xenbase X. laevis v9.1)
Supplementary_files_format_and_content: tab delimited text file with gene id and read count (for RNA-seq and Ribo-seq); tab delimited text file with gene id, cluster id and tail length (for PAL-seq and TAIL-seq); *hits.txt files are raw signal intensities from Hiseq 2000 sequencing which are used with a custom algorithm to call poly(A) tail lengths
|
| |
|
| Submission date |
Feb 10, 2021 |
| Last update date |
Jul 07, 2021 |
| Contact name |
David Bartel |
| Organization name |
Whitehead Institute
|
| Street address |
455 Main Street
|
| City |
Cambridge |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL18936 |
| Series (1) |
| GSE166544 |
The molecular basis of coupling between poly(A)-tail length and translational efficiency |
|
| Relations |
| BioSample |
SAMN17860459 |
| SRA |
SRX10069206 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5074372_frog_oocyte_PABPC1_TAIL_seq_hits.txt.gz |
23.7 Gb |
(ftp)(http) |
TXT |
| GSM5074372_frog_oocyte_PABPC1_TAIL_seq_processed_all_tails.txt.gz |
33.3 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
