NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5398528 Query DataSets for GSM5398528
Status Public on Nov 19, 2021
Title E07_MS257_215
Sample type SRA
 
Source name Cynomolgus monkey embryo E07
Organism Macaca fascicularis
Characteristics tissue: embryo
developmental stage: E07
sequencer: Nextseq550, High, 75 cycle
Growth protocol For cultivation of CMK6 and CMK9 cyESCs, they were cultured with conventional hESC medium [DMEM/F12 supplemented with 20% (vol/vol) of KSR, 1 mM of sodium pyruvate, 2 mM of GlutaMax, 0.1 mM of non-essential amino acids, 0.1 mM of 2-mercaptoethanol, 1000 U/ml of ESGRO mouse LIF, and 4 ng/ml of recombinant human bFGF] on mouse embryonic feeders (MEFs).
Extracted molecule total RNA
Extraction protocol For SC3-seq analysis, cDNA synthesis / amplification from single cells and library construction from the cDNAs were performed as described previously [Nakamura et al. 2015, NAR, 43, e60; Ishikura et al. 2016, Cell Reports, 17, 2789].
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model NextSeq 550
 
Description Single cell transcriptome of amplified cDNA from cynomolgus monkey embryo at E07
Data processing All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-e 0.1 -q 20 -n 2 -O 1 -m 30 -a CTCGAGGGCGCGCCGGATCC -g CTCGAGGGCGCGCCGGATCC -a AAAAAAAAAAAAAAAAAAAA -a TTTTTTTTTTTTTTTTTTTT". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the Cynomolgus monkey genome Macfac5.0 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—max-mle-iterations 50000", “—no-length-correction” and “—library-type fr-secondstrand” options and macfas5.0 reference gene annotations with extended TTSs. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: Macaca fascicu;aris 5.0
Supplementary_files_format_and_content: tab-delimited text files *rpm.txt include RPM values (cufflinks) or *count.txt include Read counts (HTSeq) for each Sample
 
Submission date Jun 24, 2021
Last update date Nov 19, 2021
Contact name Yukihiro Yabuta
E-mail(s) [email protected]
Organization name Kyoto University, Graduate school of medicine
Department Anatomy and Cell Biology
Street address Yoshida-Konoe-cho, Sakyo-ku
City Kyoto
State/province Kyoto
ZIP/Postal code 606-8501
Country Japan
 
Platform ID GPL27448
Series (1)
GSE151149 The X-chromosome dosage compensation program during the development of cynomolgus monkeys
Relations
BioSample SAMN19858054
SRA SRX11218939

Supplementary file Size Download File type/resource
GSM5398528_E07_MS257_215_count.txt.gz 201.0 Kb (ftp)(http) TXT
GSM5398528_E07_MS257_215_rpm.txt.gz 212.9 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap