GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5413703

Query DataSets for GSM5413703

Status

Public on Jul 06, 2021

Title

ECTV_CD8_Gzmb_3

Sample type

SRA

Source name

liver T cell

Organism

Mus musculus

Characteristics

lineage: CD8
infection state: ECTV
population: CD44 hi Gzmb

Extracted molecule

total RNA

Extraction protocol

RNA was extracted using RNA Clean and Concentrator-5' kit from Zymo Research eluting in 25 microliter of elution buffer following manufacturer instructions. Samples were treated in column with Dnase I. Up to 1 million sorted cells were used for each sample in RNA extraction.
Briefly, mRNA from Eukaryote organisms is purified from total RNA using poly-T oligo-attached magnetic beads (For prokaryotes, mRNA was purified through the removal of rRNA by using kit). The mRNA is first fragmented randomly by addition of fragmentation buffer. Then first strand cDNA is synthesized using random hexamer primer and M-MuLV Reverse Transcriptase (RNase H-). Second strand cDNA synthesis is subsequently performed using DNA Polymerase I and RNase H. Double-stranded cDNA is purified using AMPure XP beads. Remaining overhangs of the purified double-stranded cDNA are converted into blunt ends via exonuclease/polymerase activities. After adenylation of 3' ends of DNA fragments, NEBNext Adaptor with hairpin loop structure is ligated to prepare for hybridization(1). In order to select cDNA fragments of preferentially 150~200 bp in length, the library fragments are purified with AMPure XP system (Beckman Coulter, Beverly, USA). Finally, the final library is gotten by PCR amplification and purification of PCR products by AMPure XP beads.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NovaSeq 6000

Description

Cytotoxic CD8

Data processing

Raw image data file from high-throughput sequencing (Illumina) is transformed to Sequenced Reads by CASAVA base recognition (Base Calling). Raw Data is stored in FASTQ format files, which contain reads sequence and corresponding base quality. FASTQ format described by four lines: Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line). Line 2 is the raw sequence letters. Line 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
The Sequenced Reads/raw reads often contain low quality reads or reads with adaptors. As we can see in Fig 1.3, which will affect the further analysis results. In order to avoid this, it's necessary to filter the raw reads under conditions to get the clean reads. Raw reads filtering conditions are as follows: (1) Remove reads containing adaptors; (2) Remove reads containing N > 10% (N represents base that could not be determined); (3) The Qscore (Quality value) of over 50% bases of the read is <= 5. RNA-seq Adapter information: NEBNext® UltraTM RNA Library Prep Kit RNA 5' Adapter(5'Adaptor) 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT RNA 3' Adapter(3'Adaptor,The underlined 6bp bases is Index) 5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
STAR software is used to map reads to reference genome
Differential expression analysis of two conditions/groups was performed using the DESeq2 R package.
KEGG analysis was performed using KEGG database. Heatmap cluster analysis, PCA, and volcano plots were generated using python packages matplotlib, seaborn, and pandas
Genome_build: mm10
Supplementary_files_format_and_content: Tab-delimited files. Two files contain total count or relative count (fpkm) of all genes for every sample. Differentially expressed gene (DEG) files compare two populations of T cells as indicated in file name and lists any genes that are significantly different between the two groups of samples. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis files highlight enriched pathways between two groups listed in file name.

Submission date

Jul 01, 2021

Last update date

Jul 06, 2021

Contact name

Luis Sigal

E-mail(s)

[email protected]

Organization name

Thomas Jefferson University

Department

Microbiology and Immunology