|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jul 07, 2021 |
Title |
10-11-21_A |
Sample type |
SRA |
|
|
Source name |
flag leaf
|
Organism |
Hordeum vulgare |
Characteristics |
cultivar: 10_11 (Jukanti et al.2008) tissue: flag leaf age: 21 days post anthesis
|
Treatment protocol |
Once plants reached anthesis, each shoot utilized for further experimentation was tagged with its exact anthesis date. Flag leaves were harvested at 7, 14, and 21 days past anthesis and immediately shock-frozen in liquid nitrogen
|
Growth protocol |
plants were grown in a small randomized block design in a glasshouse. Plants were kept at ~22 °C during the day and ~18 °C during the night; days were extended to a 16-hour photoperiod when required, using GE Multi-Vapor MVR1000/C/U lights (General Electric, Cleveland, OH, USA). Plants in potting soil were fertilized with 250 ml Peter's Professional General Purpose fertilizer (4 g l-1; Scotts-Sierra Horticultural Products Company, Marysville, OH, USA) per 4-liter pot with three plants. Fertilizer was applied every alternate week until anthesis, starting at 2 weeks after germination. Additionally, a treatment with 100 ml 16 mM KNO3 (Sigma-Aldrich, St. Louis, MO, USA) was applied twice per week, per pot, from germination to anthesis.
|
Extracted molecule |
total RNA |
Extraction protocol |
Each sample/replicate consisted of at least 10 flag leaves, and three independent samples/replicates were harvested for both 'Karl' and '10_11' at each time point. the samples were immediately shock-frozen in liquid nitrogen and RNA was extracted separately from frozen tissues using a standard Trizol extraction method (Sigma-Aldrich). Libraries were prepared with the MARS-seq protocol (Diego Adhemar Jaitin, 2017) and sequenced using Illumina NextSeq 500 High Output v2 Kit (75 cycles).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
Barley flag leaves at increasing stage of senescence, from 7 to 21 days post anthesis X6F
|
Data processing |
Bcl files were converted into fastq by bcl2fastq. Demultiplexing is done using the sample barcode found on R2, the UMI found on R2 is inserted in the read name (in R1 fastq). R1 Fastq data submitted. MARS-seq analysis was done using the UTAP transcriptome analysis pipeline (Kohen et al., 2019). Reads were trimmed using cutadapt, (parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a “A{10}” –times 2 -u 3 -u -3 -q 20 -m 25). Reads were mapped to the barley genome (Mascher et al. 2017) using STAR, v2.4.2a (parameters: –alignEndsType EndToEnd, –outFilterMismatchNoverLmax 0.05, –twopassMode Basic, –alignSoftClipAtReferenceEnds No). The pipeline quantifies the 3’ of Araport annotated genes (The 3’ region contains 1,000 bases upstream of the 3’ end and 100 bases downstream): We used the 3 end (1000bp) of the transcripts for counting the number of reads per gene. Counting (UMI counts) was done after marking duplicates (in-house script) using HTSeq-count (DOI: 10.1093/bioinformatics/btu638) in union mode. Further analysis is done for genes having minimum 5 read in at least one sample. Genome_build: barley genome (Mascher et al. 2017) Supplementary_files_format_and_content: Normalization of the counts and differential expression analysis was performed using DESeq2 , with the parameters: betaPrior=True, cooksCutoff=FALSE, independentFiltering=FALSE. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg.
|
|
|
Submission date |
Jul 06, 2021 |
Last update date |
Jul 09, 2021 |
Contact name |
Robert Fluhr |
E-mail(s) |
[email protected]
|
Phone |
0505109621
|
Organization name |
Weizmann institute of science
|
Department |
Plant and environmental sciences
|
Lab |
Robert Fluhr
|
Street address |
hertzl 234, 17
|
City |
Rehovot |
ZIP/Postal code |
7644609 |
Country |
Israel |
|
|
Platform ID |
GPL26320 |
Series (1) |
GSE179555 |
Transcriptome analysis of Barley flag leaf during senescence |
|
Relations |
BioSample |
SAMN20081324 |
SRA |
SRX11361503 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|