|
| Status |
Public on Apr 22, 2022 |
| Title |
TSS SCO5820_4 |
| Sample type |
SRA |
| |
|
| Source name |
In vitro transcription
|
| Organism |
Streptomyces coelicolor A3(2) |
| Characteristics |
sample type: Sigma factor SCO5820, replicate # 4
|
| Treatment protocol |
With or without a sigma factor
|
| Growth protocol |
The genomic DNA of S. coelicolor A3(2) was isolated by using GenElute Bacterial Genomic DNA kit (MilliporeSigma) and digested by EcoRI, HindIII, BamHI or XhoI. Equal quantities of the genomic DNA solutions treated by different restriction enzymes were combined. In vitro transcription assays were performed using Echo® 525 LIQUID HANDLER (Labcyte). Two µl of 8 µM sigma factor, 1 µl of 1 unit/µl E. coli RNA polymerase core enzyme (New England BioLabs) and 2 µl of 5X E. coli RNA polymerase reaction buffer were mixed and incubated at 30ºC for 15 min. To this mixture, 1 µl of 200 ng/µl digested genomic DNA mixture was added and the mixture was incubated at 30ºC for 15 min. The in vitro transcription reaction was initiated by adding 2 µl of 2.5 mM NTP mixture (Invitrogen) and the mixture was incubated at 30ºC for 20 min. To the reaction was the DNase solution consisting of 2 µl TURBO DNase (2 units/µl; Ambion), 1.5 µl of 10X TURBO DNase buffer and 1 µl of ERCC RNA Spike-in Mix (Invitrogen) diluted by 100 times added. The reaction was incubated at 37ºC for 30 min and the RNAs were purified using RNeasy kit (Qiagen).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNeasy kit (Qiagen)
The triphosphates at the 5’ end of 6 µg RNA samples were converted to monophosphates by using 3.75 units of RNA 5’ pyrophosphohydrolase (RppH; New England BioLabs) at 30ºC for 1 hour. The 5’ ends of the transcripts were ligated by the adaptor (GUUCAGAGUUCUACAGUCCGACGAUC) using 15 units of T4 RNA ligase 1 (ssRNA ligase; New England BioLabs) at 25ºC for 2 hours followed by incubation at 17ºC for 18 hours. Ligated RNA samples were purified by using RNeasy Kits and RNeasy MinElute Cleanup Kits (QIAGEN). cDNA was synthesised by using a random hexamer with an adaptor sequence (GCCTTGGCACCCGAGAATTCCANNNNNN) and SuperScript IV First-Strand Synthesis System (Invitrogen). The cDNA was amplified by using KAPA Library Amplification Kit (Roche) and index primers from TruSeq Small RNA Library Preparation Kit (Illumina). Libraries were purified by using the equal volume of AMPure XP (Beckman Coulter) twice.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
SCO5820_4
|
| Data processing |
Adaptor sequences present at the 3’ end of reads were trimmed using BBDuk
Raw reads were scanned from 3’ to 5’ and those with a quality score value below 20 were trimmed and reads consisting of fewer than 35 nucleotides were discarded using BBDuk
Trimmed reads were aligned to the S. coelicolor A3(2) chromosome and ERCC92 sequences using HISAT2 with the “no-spliced-alignment” option and the “maxins” option of 1,000
The 5’ end of the forward reads that aligned each genomic position was counted using Samtools
5’ ends within 100 bp were clustered together. If multiple 5’ ends located nearby had standard deviation of < 10, they were subclustered together and the 5’ end that had the largest read count within the subcluster was considered the TSS. The sum of the read counts of all the 5’ ends within the subcluster was used as the read count of the TSS. ERCC92 transcripts that had at least 10 reads aligning the 1st nucleotide in all the replicates were used as normalisation control. The read count relative to the maximum number among samples were calculated for each ERCC92 transcript and the mean value of all the relative read counts were used as the normalisation factor, which ranges between 0 and 1. TSSs with the normalised read counts (read counts divided by the mean normalisation factor) of < 4 in at least one of the replicates in the sample with a sigma factor were removed from the further analysis.
Genome_build: Streptomyces coelicolor A3(2)
Supplementary_files_format_and_content: CSV file with 5' read count
|
| |
|
| Submission date |
Sep 18, 2021 |
| Last update date |
Apr 24, 2022 |
| Contact name |
Hiroshi Otani |
| E-mail(s) |
[email protected]
|
| Phone |
5104958541
|
| Organization name |
Lawerence Berkeley National Laboratory
|
| Department |
DOE Joint Genome Institute
|
| Street address |
1 Cyclotron Road
|
| City |
Berkeley |
| State/province |
CA |
| ZIP/Postal code |
94720 |
| Country |
USA |
| |
|
| Platform ID |
GPL30647 |
| Series (1) |
| GSE184392 |
RIViTseq enables systematic identification of regulons of transcriptional machineries I |
|
| Relations |
| BioSample |
SAMN21502082 |
| SRA |
SRX12250312 |
