|
| Status |
Public on Oct 15, 2021 |
| Title |
PFA fixed lung_organoid_4 |
| Sample type |
SRA |
| |
|
| Source name |
PFA fixed lung organoid
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: lung organoid
sample type: PFA fixed
|
| Treatment protocol |
Tissues were sectioned and placed on a glass slide followed by HE staining
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Tissues were decrosslinked and enzymatically permeabilized
RNA libraries were prepared for sequencing following the 10x Genomics Visium protocol
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
V19D02-088_D1_S4
|
| Data processing |
library strategy: Spatial Transcriptomics (10x Visium)
bcl2fastq command line tool was used for base calling
Sequence reads were trimmed for adapter sequence (Template Switch Oligo) and polyA homopolymers using cutadapt (-g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA ;max_error_rate=0--overlap 5 -n 2)
Reads were mapped, annotated and demultiplexed using the spaceranger v1.0.0 command line tool
Annotated reads were quantified and mapped to the Hematoxylin and Eosin image using the spaceranger v1.0.0 command line tool
Genome_build: mm10 for Mus musculus and GRCh38 for Homo sapiens
Supplementary_files_format_and_content: Matrix with raw counts for every gene and every spot, filtered to include spots under tissue
Supplementary_files_format_and_content: Hematoxylin and Eosin (HE) image in JPG format
Supplementary_files_format_and_content: Low resolution Hematoxylin and Eosin (HE) image in PNG format
Supplementary_files_format_and_content: Scalefactors in json format
Supplementary_files_format_and_content: Table with array and pixel coordinates
|
| |
|
| Submission date |
Oct 12, 2021 |
| Last update date |
Oct 16, 2021 |
| Contact name |
Ludvig Ale Larsson |
| E-mail(s) |
[email protected]
|
| Phone |
+46739911122
|
| Organization name |
SciLifeLab
|
| Department |
Gene Technology
|
| Street address |
Tomtebodavägen 23A
|
| City |
Solna |
| State/province |
Stockholm |
| ZIP/Postal code |
17165 |
| Country |
Sweden |
| |
|
| Platform ID |
GPL30173 |
| Series (1) |
| GSE185715 |
Genome-wide Spatial Expression Profiling in Formalin-fixed Tissues |
|
| Relations |
| BioSample |
SAMN22224912 |
| SRA |
SRX12575982 |
