|
| Status |
Public on Apr 02, 2022 |
| Title |
Mut_Lac3 |
| Sample type |
SRA |
| |
|
| Source name |
Cell culture
|
| Organism |
Bifidobacterium longum subsp. infantis |
| Characteristics |
background strain: ATCC 15697
nagr genotype: Mut
carbon source: Lac
|
| Growth protocol |
Bifidobacterium longum subsp. infantis ATCC 15697 WT and nagR knockout mutant (nagR-KO or Mut) were grown in MRS-CS supplemented with either 1% lactose or 1% LNnT. Samples (2 ml in triplicates) were collected at the early-mid exponential phase (OD600=0.35) and immediately pelleted in a prechilled centrifuge at 4,800 × g for 5 min. Cell pellets were snap-frozen in liquid nitrogen and stored at −80 °C until further use
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Frozen cell pellets were kept on dry ice and resuspended in a solution containing 250 µL of acid-washed glass beads (212-300 μm), 710 µL of extraction mixture (200 mM NaCl, 20 mM EDTA, 20% SDS), and 500 µL of a mixture of phenol:chloroform:isoamyl alcohol (125:24:1, pH 4.5). Cells were disrupted using Bead Ruptor 12 (Omni International) by alternating 2 min of homogenizing at 6 m/s and 2 min of cooling on ice. Cellular debris was removed by centrifugation (16,000 × g for 10 min), and the aqueous phase was collected. RNA was precipitated with isopropanol and sodium acetate (pH 5.5) at −20 °C overnight, then washed in ice-cold 70% ethanol and resuspended in 100 µL of nuclease-free water. Total RNA was subjected to two consecutive DNase treatments (30 min each) with Baseline-ZERO DNase (Lucigen) and Turbo DNase (Ambion), respectively. Each treatment was followed by cleanup using MEGAclear Transcription Clean-Up Kit (Ambion). RNA was quantified via Qubit Broad Range RNA Assay Kit (Invitrogen), and RNA integrity was confirmed by gel electrophoresis in 1 % agarose and 4200 TapeStation System (Agilent). All samples had RIN > 7.5
Ribosomal RNA was depleted with NEBNext rRNA Depletion Kit for Bacteria (New England Biolabs). Barcoded libraries were made with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Libraries were pooled and sequenced (single-end 75 bp reads) on Illumina NextSeq 500 using High Output V2 Kit (Illumina)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Raw reads were demultiplexed and quality checked via FastQC (v0.11.9)
Illumina sequencing adapters and short reads (< 20 bp) were trimmed by Cutadapt (v3.4) with parameters: -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC
Reads were aligned to rRNA gene sequences extracted from the Bifidobacterium longum subsp. infantis ATCC 15697 genome using Bowtie2 (v2.4.4) to filter rRNA reads
Unmapped (filtered) reads were pseudoaligned to the Bifidobacterium longum subsp. infantis ATCC 15697 transcriptome via Kallisto (v0.46.2) with parameters: --single -l 200 -s 20
Kallisto transcript quantification data were imported into R using the TxImport package and normalized by the TMM method in the edgeR package
Genes with < 1 count per million (CPM) in ≤ 3 samples were filtered out
Normalized, filtered data were variance-stabilized using the VOOM function in the Limma package in R
Differentially expressed genes (>2-fold and <1% false discovery rate) were identified by linear modeling and Bayesian statistics using the Limma package
Genome_build: Bifidobacterium longum subsp. infantis ATCC 15697 (GenBank accession no. CP001095.1; locus tags Blon_xxxx)
Supplementary_files_format_and_content: tab-delimited txt file that includes a matrix with raw gene counts for every gene and every sample
|
| |
|
| Submission date |
Feb 03, 2022 |
| Last update date |
Apr 02, 2022 |
| Contact name |
Aleksandr Arzamasov |
| E-mail(s) |
[email protected]
|
| Organization name |
Sanford Burnham Prebys Medical Discovery Institute
|
| Street address |
10901 N Torrey Pines Rd
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92037 |
| Country |
USA |
| |
|
| Platform ID |
GPL28926 |
| Series (1) |
| GSE196064 |
Human Milk Oligosaccharide Utilization in Intestinal Bifidobacteria is Governed by Global Transcriptional Regulator NagR |
|
| Relations |
| BioSample |
SAMN25637727 |
| SRA |
SRX14032872 |
