 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 14, 2011 |
| Title |
[E-MTAB-706] wt1 |
| Sample type |
SRA |
| |
|
| Source name |
wt1
|
| Organism |
Campylobacter jejuni |
| Characteristics |
material type: whole_organism
genotype: wild_type
strainorline: NCTC11168
|
| Growth protocol |
grow | C. jejuni strains were cultured for 48 hours on MH blood agar plates with antibiotics added as appropriate. Bacterial lawns were harvested in 1 ml BHI broth, 50 ul of which was inoculated into 10 ml BHI broth in a 50 ml Falcon centrifuge tube with a loosened cap, and grown for 16 h at 42C under microaerobic conditions with agitation at 150 rpm to generate a starter culture. The optical density at 600nm (OD600) of starter cultures was taken using a 6305 UV/Visible Spectrophotometer (Jenway, Dunmow, U.K.). Starter cultures were diluted appropriately in BHI broth and used to inoculate 10 ml of BHI broth containing 10 ug/ml trimethoprim in a 50 ml falcon tube (previously equilibrated at 42C in microaerobic conditions for 16 h) to a calculated OD600 of 0.00002. Cultures were grown at 42C under microaerobic conditions with shaking at 150 rpm for 24 h. Growth was monitored by recording OD600, and by determining viable colony forming units (CFU/ml) by serial 10-fold dilution of cultures in BHI broth and plating onto MH agar. Plates were incubated microaerobically at 42C for 48 h before colonies were counted.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
nucleic_acid_extraction | C. jejuni cultures were fixed with 2 volumes of RNA protect Bacteria (Qiagen) and harvested. RNA was isolated from the pellet using the SV RNA isolation kit (Promega) according to the manufacturers instructions. 23S and 16S rRNAs were depleted using a MicrobExpress kit (Ambion). Genomic DNA was removed with two digestions, using Amplification grade DNAse I (Invitrogen), to below PCR-detectable levels. RNA was reverse transcribed using random primers (Invitrogen) and Superscript III (Invitrogen) at 45C for 3 h and denatured at 70C for 15 min. leuB (using primers QJAW084 5 GCAAGTATAGATGCTTATGGAGTG 3 and QJAW085 5 CTCTTTCAGGTCTTTGATCTATGG 3), aroA (using primers QJAW092 5 GCTTTGGCTAAGGGTAAATCTAGT 3 and QJAW093 5 ATCAAGTTCTCTAGCTTCAACACC 3), lpxD (using primers QJAW104 5 GGAGCTTATATAGGCGATAATGTC 3 and QJAW105 5 CAAAACCGTCACTTCCTATTACAC 3) and guaB (using primers QJAW108 5 GGGTGTTGATGTTGTTGTGC 3 and QJAW109 5 GGCGATATTTCCTGCGATAA 3) were used as targets for a PCR as a positive control for reverse transcription.
sequencing | Sequencing libraries for the Illumina GA platform were constructed by shearing the enriched cDNA by nebulisation (35psi, 6 min) followed by end-repair with Klenow polymerase, T4 DNA polymerase and T4 polynucleotide kinase (to blunt-end the DNA fragments). A single 3 adenosine moiety was added to the cDNA using Klenow exo- and dATP. The Illumina adapters (containing primer sites for sequencing and flowcell surface annealing) were ligated onto the repaired ends on the cDNA and gel-electrophoresis was used to separate library DNA fragments from unligated adapters by selecting cDNA fragments between 200â250 bps in size. Fragmentation followed by gel-electrophoresis were used to separate library DNA fragments and size fragments were recovered following gel extraction at room temperature to ensure representation of AT rich sequences. Ligated cDNA fragments were recovered following gel extraction at room temperature to ensure representation of AT rich sequences. Libraries were amplified by 18 cycles of PCR with Phusion polymerase. Sequencing libraries were denatured with sodium hydroxide and diluted to 3.5 pM in hybridisation buffer for loading onto a single lane of an Illumina GA flowcell. Cluster formation, primer hybridisation and single-end, 36 cycle sequencing were performed using proprietary reagents according to manufacturers' recommended protocol (https://icom.illumina.com/). The efficacy of each stage of library construction was ascertained in a quality control step that involved measuring the adapter-cDNA on a Agilent DNA 1000 chip. A final dilution of 2 nM of the library was loaded onto the sequencing machine.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
Performer: SC
|
| Data processing |
processed data not provided
|
| |
|
| Submission date |
Jul 12, 2011 |
| Last update date |
May 15, 2019 |
| Organization |
European Bioinformatics Institute |
| E-mail(s) |
[email protected]
|
| Lab |
ArrayExpress
|
| Street address |
Wellcome Trust Genome Campus
|
| City |
Hinxton |
| State/province |
Cambridgeshire |
| ZIP/Postal code |
CB10 1SD |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL13903 |
| Series (1) |
| GSE30621 |
[E-MTAB-706] Quantitative RNA-seq analysis of the transcriptome of Campylobacter jejuni |
|
| Relations |
| SRA |
ERX014110 |
| Supplementary data files not provided |
SRA Run Selector |
| Processed data not provided for this record |
| Raw data are available in SRA |
|
|
|
|
 |
