GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM7678267

Query DataSets for GSM7678267

Status

Public on Aug 08, 2024

Title

Lac1

Sample type

SRA

Source name

cell culture

Organism

Bifidobacterium catenulatum subsp. kashiwanohense

Characteristics

strain: Bg42221_1E1
cell type: cell culture
genotype: WT
carbon source: Lactose

Growth protocol

Overnight culture of Bifidobacterium catenulatum subsp. kashiwanohense Bg42221_1E1 grown in MRS-AC-Glc was harvested at 5,000 × g for 5 min, washed with sugar-free MRS-AC, and used to inoculate MRS-AC medium supplemented with either Glc, Lac, LNT (10 mg/mL) or tamarind xyloglucan (XGL) (5 mg/mL) at OD600=0.01. Samples (2 mL, biological triplicates) were collected at the early exponential phase (OD600=0.35) and immediately pelleted in a prechilled centrifuge at 4,800 × g for 5 min. Cell pellets were snap-frozen in liquid nitrogen and stored at −80°C until further use.

Extracted molecule

total RNA

Extraction protocol

Frozen cell pellets obtained from 2 ml of early exponential phase cultures (OD600=0.35) were resuspended in a solution containing 710 µL of the extraction mixture (200 mM NaCl, 20 mM EDTA, 20% SDS), 500 µL of phenol:chloroform:isoamyl alcohol (125:24:1, pH 4.5), and 250 µL of acid-washed glass beads (212-300 µm). Cells were disrupted using Bead Ruptor 12 (Omni International) by alternating 2 min of homogenizing at 6 m/s and 2 min of cooling on ice. Cellular debris was removed by centrifugation (16,000 × g for 10 min), and the aqueous phase was collected. RNA was precipitated with isopropanol and sodium acetate (pH 5.5) at −20 °C overnight, washed twice in ice-cold 70% ethanol, and resuspended in 100 µL of nuclease-free water. Total RNA was subjected to two consecutive DNase treatments (30 min each) with Turbo DNase (Ambion) and Baseline-ZERO DNase (Lucigen), respectively. Each treatment was followed by cleanup using MEGAclear Transcription Clean-Up Kit (Ambion). RNA was quantified via Qubit Broad Range RNA Assay Kit (Invitrogen), and RNA integrity was confirmed by gel electrophoresis in 1 % agarose and 4200 TapeStation System (Agilent). All samples had RIN > 8.0
Ribosomal RNA was depleted with the NEBNext rRNA depletion kit for bacteria (New England Biolabs) and a set of 20 pooled sequence-specific probes for B. kashiwanohense Bg42221_1E1 designed with NEBNext Custom RNA Depletion Design Tool v1.0. Barcoded libraries were made with NEBNext Ultra II directional RNA library prep kit for Illumina (New England Biolabs). Libraries were pooled and sequenced (single-end 75-bp reads) on Illumina NextSeq 500 using the High Output V2 kit (Illumina).

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NextSeq 500

Data processing

Raw reads were demultiplexed and quality checked via FastQC (v0.11.9). Illumina sequencing adapters and short reads (< 20 bp) were trimmed by Cutadapt (v4.11) with parameters: --nextseq-trim=20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC
Reads were aligned to rRNA gene sequences extracted from the B. kashiwanohense Bg42221_1E1 genome using Bowtie2 (v2.4.5) to filter out rRNA reads. Unmapped (filtered) reads were pseudoaligned to the B. kashiwanohense Bg42221_1E1 transcriptome via Kallisto (v0.48) with parameters: --single -l 150 -s 20 --rf-stranded
Kallisto transcript quantification data were imported into R using the TxImport package and normalized by the TMM method in the edgeR package. Genes with < 1 count per million (CPM) in ≤ 3 samples were filtered out
Normalized, filtered data were variance-stabilized using the VOOM function in the Limma package in R
Differentially expressed genes were identified by linear modeling and Bayesian statistics using the Limma package
Assembly: Bifidobacterium catenulatum subsp. kashiwanohense Bg42221_1E1
Supplementary files format and content: tab-delimited txt file that includes a matrix with raw gene counts for every gene and every sample

Submission date

Aug 03, 2023

Last update date

Aug 08, 2024

Contact name

Aleksandr Arzamasov

E-mail(s)

[email protected]

Organization name

Sanford Burnham Prebys Medical Discovery Institute

Street address

10901 N Torrey Pines Rd