|
| Status |
Public on Aug 08, 2024 |
| Title |
NitrogenMinus, RNA-seq, Replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
archaeal cell
|
| Organism |
Methanosarcina mazei Go1 |
| Characteristics |
cell type: archaeal cell
growth condition: NitrogenMinus
fraction: rRNA-depleted, fragmented total RNA
|
| Treatment protocol |
No treatment applied during growth.
|
| Growth protocol |
M. mazei Gö1 was cultivated either under nitrogen sufficient (+N) or nitrogen limited conditions (-N) as described (Ehlers et al. 2002). Cells corresponding to 60 OD600 equivalent units were harvested rapidly by fast-chilling in an ice bath to halt cell growth and translation, without the use of antibiotics
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted from fractions or cell pellets for total RNA using hot phenol-chloroform-isoamyl alcohol (25:24:1, Roth) or hot phenol (Roth), respectively, as described previously (Sharma et al. 2007).
Total RNA was first rRNA-depleted, fragmented then subjected to cDNA library preparation. Size selcted RNA for Riboseq samples were directly subjected to cDNA library preparation. The obtained small RNA samples were first treated with Antarctic Phosphatase and re-phosphorylated with T4 Polynucleotide Kinase (PNK). Then, oligonucleotide adapters were ligated to the 5' and 3' ends of the RNA samples. First-strand cDNA synthesis was performed using M-MLV reverse transcriptase and the 3’ adapter as primer. The resulting cDNA was amplified with PCR using a high fidelity DNA polymerase.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
Total RNA extracted from WT strain biological replicate 1 under nitrogen minus condition, DNaseI digested, rRNA depleted, fragmented and subjected to cDNA library preparation
|
| Data processing |
Base calling with Illumina NextSeq RTA v2.4.11
FASTQ conversion with bcl2fastq v2.20.0.422
FASTQ quality and adapter trimming using Cutadapt (Martin, 2011) version 2.1 (cutadapt parameters: -q 20 --trim-n -m 10 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) (HRIBO 1.7.0)
Mapping with segemehl 0.3.4 (HRIBO 1.7.0)
rRNA filtering was done using samtools 1.9 (HRIBO 1.7.0)
Coverage files were created using HRIBO 1.7.0
Assembly: ASM706v1
Supplementary files format and content: bigwig format files containing normalized read coverage for each sample
|
| |
|
| Submission date |
Aug 10, 2023 |
| Last update date |
Aug 08, 2024 |
| Contact name |
Rick Gelhausen |
| E-mail(s) |
[email protected]
|
| Organization name |
Albert-Ludwigs-University Freiburg
|
| Department |
Department of Computer Science
|
| Lab |
Bioinformatics Group (AG Backofen)
|
| Street address |
Georges-Köhler-Allee 106
|
| City |
Freiburg |
| State/province |
Baden Württemberg |
| ZIP/Postal code |
79110 |
| Country |
Germany |
| |
|
| Platform ID |
GPL33665 |
| Series (1) |
| GSE240615 |
Small proteome of Methanosarcina mazei: Insights from Ribo-seq and peptidomics under different nitrogen conditions |
|
| Relations |
| BioSample |
SAMN36939417 |
| SRA |
SRX21331909 |
