 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 09, 2024 |
| Title |
RIV A8 354 bp 5hmC template 2 µM dGTP and 200 µM d(A/T/C)TP |
| Sample type |
SRA |
| |
|
| Source name |
DNA template generated by PCR using modified d5hmCTP
|
| Organism |
synthetic construct |
| Characteristics |
tissue: synthetic construct
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
artificial template generated by PCR
For samples with DNA template generated by PCR using modified dCTPs:
Reaction mixtures for linear PCR contained 2 µM dGTP and 200 µM d(A/T/C)TP (each), 100 nM 127 bp reverse primer, 50 pM 354 bp C, 5mC or 5hmC template and 250 nM RIV A8 KTq variant in 1x KTq reaction buffer (50 mM Tris HCl (pH 9.2), 16 mM (NH4)2SO4, 2.5 mM MgCl2, 0.1% (v/v) Tween 20). PCR was performed in 25 µL with an initial denaturation at 95°C for 3 min followed by amplification over 20 cycles with denaturation at 95°C for 10 s, annealing at 56°C for 30 s and elongation at 72°C for 8 min. Final elongation was performed for 10 min at 72°C. Single-stranded (ssDNA) PCR product from 109 to 127 nt was purified by preparative agarose gel electrophoresis using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel) in combination with the NTC binding buffer according to the manufacturer’s instructions with elution in 22 µL Milli-Q water. To verify that no original template DNA was extracted, 1 µL of purified PCR product was subsequently applied in a PCR for purity verification. Reaction mixtures contained 200 µM dNTPs (each), 500 nM 354 bp forward and reverse primer, 10% (v/v) PCR product as template and 0.02 U/µL Q5® Hot Start High-Fidelity DNA Polymerase in 1x Q5® Reaction Buffer (New England Biolabs). PCR was performed in 10 µL reaction mixtures with an initial denaturation at 98°C for 1 min followed by amplification over 25 cycles with denaturation at 98°C for 10 s, annealing at 60°C for 30 s and elongation at 72°C for 30 s. Final elongation was performed for 2 min at 72°C. The absence of the 354 bp PCR product was verified by agarose gel electrophoresis. 17.5 µL of purified linear PCR product ssDNA was treated with the PreCR® Repair Mix (New England Biolabs) in 20 µL according to the manufacturer’s instructions (100 µM dNTPs (each), 1x NAD+, 1 µL PreCR® Repair Mix in 1x ThermoPol® Reaction Buffer for 20 min at 37°C). Without further purification, the reaction mixture was applied in a 2-cycle UMI PCR. Reaction mixtures for UMI introduction contained 200 µM dNTPs (each), 200 nM forward and reverse UMI primer, 0.02 U/µL Q5® Hot Start High-Fidelity DNA Polymerase and 0.2x Q5® Reaction Buffer (New England Biolabs) in 25 µL end volume. PCR was performed with an initial denaturation at 98°C for 1 min followed by primer elongation over 2 cycles with denaturation at 98°C for 10 s, annealing at 48°C for 30 s and elongation at 72°C for 30 s. Final elongation was performed for 2 min at 72°C. 183 bp UMI PCR product was purified by preparative agarose gel electrophoresis using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel) according to the manufacturer’s instructions. To improve purification, NTI binding buffer was 1:1.5 diluted with Milli-Q water for solubilising agarose gel slices and the dissolved mixture was diluted in total to 1:2.5 prior to DNA binding on the purification column. Purified UMI PCR product was eluted in 15 µL Milli-Q water. DNA concentration was determined by qPCR using previously prepared 183 bp reference DNA in decadic dilution series for the quantification based on standard amplification curves. Reaction mixtures contained 0.96x NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 400 nM 183 bp forward and reverse primer, 1x SYBR Green I (Sigma-Aldrich) and 1.85 µL reference template or UMI PCR product elution in 5 µL end volume. qPCR was performed in a Light Cycler® 96 instrument (Roche Diagnostics) with an initial denaturation at 98°C for 1 min followed by amplification over 30 cycles with denaturation at 98°C for 10 s, annealing at 60°C for 30 s and elongation at 72°C for 30 s. High resolution melting curves were measured immediately after PCR amplification. For absolute quantification, Cq values of reactions with reference template were plotted against the logarithm of their DNA concentrations and the linear regression function was used to calculate the concentration of the UMI PCR product. Calculated concentrations were multiplied by two, because applied reference template DNA was double stranded and only one strand of UMI PCR product carried both primer binding sites. Reactions for reference and UMI DNA were performed twice and a no template control reaction was performed to determine side product signals. The minimum reaction efficiency for the standard curve was 0.9 to 1.1 and the cut-off for the correlation coefficient of linear regression was 0.98. 67.63 fM of purified UMI PCR product was treated with the PreCR® Repair Mix (New England Biolabs) in 11.25 µL according to the manufacturer’s instructions. Without further purification, the reaction mixture was applied in the Amplicon PCR. Reaction mixtures for Amplicon library preparation contained 1x NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 400 nM forward and reverse Amplicon primer (containing Illumina TruSeq adapter and indexes sequences) and 26.57 fM UMI PCR product (for final analysis of approximately 100 000 UMI families) in 25 µL end volume. PCR was performed with an initial denaturation at 98°C for 1 min followed by amplification over 35 cycles with denaturation at 98°C for 10 s, annealing at 70°C for 30 s and elongation at 72°C for 30 s. Final elongation was performed for 2 min at 72°C. 263 bp Amplicon PCR product was purified by preparative agarose gel electrophoresis using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel) according to the manufacturer’s instructions. To improve purification, NTI binding buffer was 1:1.5 diluted with Milli-Q water for solubilising agarose gel slices and the solved mixture was diluted in total to 1:6.5 prior to DNA binding on the purification column. The PCR product was eluted in 20 µL Milli-Q water and treated with the PreCR® Repair Mix (New England Biolabs) in 20 µL according to the manufacturer’s instructions. Repaired product DNA was purified using the QIAEX II system (Qiagen) according to the manufactures instructions and was eluted in 18 µL Milli-Q water. DNA library concentrations were determined using the Quantus™ Fluorometer (Promega). After quality control by electrophoresis with the Bioanalyzer 2100 system (Agilent), DNA libraries were pooled equimolarly and sequencing was performed in paired-end mode on a NextSeq 2000 system with 2 x 75 bp read length. Each prepared NGS library was prepared and sequenced once.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
354 bp 5hmC template
(2*75 bp)
|
| Data processing |
Sequencing data were processed by using the open source software KNIME 4.6.2
Raw sequence and quality values were extracted from the FASTQ file format and Phred quality scores (Q scores) were transformed into base calling error probabilities (P)
The data was preprocessed by defining the unique molecular identifier (UMI) sequence context and translating Read 1 sequence and P into the reverse complement orientation
Read 1 and Read 2 were aligned to give the expected size of the template (109 bp) and merged into one sequence for which base calls with the lower error probability were transferred for the Read 1 and Read 2 overlay segment
High quality data was filtered by removal of reads containing a base within the UMI contexts with a P value above the threshold or removal of merged reads with a mean error probability over all bases in the sequence context above the threshold value
For each filtered read, a deletion and insertion correction was performed to adjust frameshifts by employing the Levenshtein distance between the read and reference template
N base calls were replaced by reference bases to prevent false positive error detection
Reads were aligned to the reference template sequence and reads with a misalignment higher as 13% were removed from the data set
Reads were sorted into UMI family groups with identical UMIs and analysis was proceeded with UMI families containing a minimum of three reads
Error calculation of UMI families was performed by averaging over the error for each sequence position of each read in one UMI family
By employing an error cut-off of 0.9, true KlenTaq DNA polymerase derived errors were then set to 1 and errors below the cut-off were set to 0 for each UMI family
The mean error was calculated over all UMI families at each sequence position, yielding the KTq based error rate
5mC detection was facilitated by comparing the error rates of the unmodified C template data set with the error rates of the 5mC template sequencing data using the Microsoft Excel software. 5hmC detection was facilitated by comparing the error rates of the unmodified C template data set with the error rates of the 5hmC template sequencing data using the Microsoft Excel software
Assembly: CTTACCCTATCTCTTCCCTAGTTTTCGACATCCGGAGCCTAGTTCTTCTGATCCACCATATAGATATTAATGGGAGGCAGAAATGCGTGTTAGGTAAAAGTTCGTCGTC
Supplementary files format and content: excel-files include position, reference DNA sequence, error rates and base calls
Library strategy: DNA Amplicon-Seq
|
| |
|
| Submission date |
Jun 26, 2024 |
| Last update date |
Sep 09, 2024 |
| Contact name |
Melanie Henkel |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Konstanz
|
| Department |
Department of Chemistry
|
| Lab |
AG Marx
|
| Street address |
Universitätsstraße 10
|
| City |
Konstanz |
| State/province |
Baden-Württemberg |
| ZIP/Postal code |
78464 |
| Country |
Germany |
| |
|
| Platform ID |
GPL32628 |
| Series (1) |
| GSE270850 |
Detection of 5mC and 5hmC in DNA templates generated by PCR using modified dCTPs by linear PCR using KTq DNA polymerase variant RIV A8 |
|
| Relations |
| BioSample |
SAMN42072186 |
| SRA |
SRX25099912 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8353452_AM94_Al13_Min3.xlsx |
18.7 Kb |
(ftp)(http) |
XLSX |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
