|
| Status |
Public on Nov 13, 2024 |
| Title |
hAFSC-iPSC-Cardiomyocyte-lac bio_rep3 |
| Sample type |
SRA |
| |
|
| Source name |
Amniotic fluid stem cell
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Amniotic fluid stem cell
cell line: AFSC-iPSC
cell type: Amniotic fluid stem cell-induced pluripotent stem cell
genotype: wild-type
treatment: Glucose-Depleted and Lactate-Supplemented Conditions
|
| Treatment protocol |
The hPSCs were differentiated followed the well-established 14 days protocol by Burridge et al (2014). On day 0, the RPMI-1640 medium contains B27 minus insulin supplement (Thermo; 1895201) and Wnt activator Chir99021 (5 µM; Stemcell Technology; 72054). On Day 2, medium was changed to RPMI-1640 supplemented with B27 minus insulin. On day 3, addition of Wnt inhibitor IWR-1 (5 µM; Sigma; I0161) to the medium. On day 7, addition of insulin (B27 supplement; Thermo; 17504044) to induce cardiomyocyte formation. The medium was changed every 2 days untill the completion of the 14 days protocol.
|
| Growth protocol |
All hPSCs include hiPSCs and hESC were cultured on Matrigel matrix (Corning; 354230) pre-coated cell culture dish in Stemflex medium (Thermo; A3349401). Addition of ROCK inhibitor Y27632 (10uM; Cayman; 10005583) allows cells to attach.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Total RNA was purifed with Direct-zol RNA MiniPrep kit (Zymo) and treated with DNAse I followed manufactorers instruction. Purify the poly(A) RNA sample by Dynabeads mRNA DIRECT purification kit (Thermo) with twice purification process, followed by bisulfite conversion reaction with three cycles of 70℃ 10minutes and 64℃ 45 minutes by EZ RNA methylation kit (Zymo).
The bisulfite treated mRNA samples librarires were generated with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs)
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq X Plus |
| |
|
| Description |
m5C_loci.xlsx
DESeq2_DEGs.xlsx
HTseqCount_raw.txt
|
| Data processing |
The raw fastq file were merge into one R1 and one R2 file by Concatenate datasets tool on Galaxy web platform.
Use Trim Galore! tool remove reads with Q score less than 20 and the adaptor seqeunces. With the followed arguments: for read 1 ‘-j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC’ and read 2 ‘-j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT’
The trimmed and quality reads were aligned to human reference genome GRCh38 (Release-100 from Ensembl website) with gene transfer format (GTF) by meRanGh align, and with arguments of maximum mismatch ratio set at 0.1 (‘-mmr 0.1’).
The SAM files were then proceed to meRanCall with arguments ‘-rl 150 -md 5 -ei 0.1 -cr 99 -fdr 0.05 -mcov 10 -mr 0.05’ to identifiy m5C sites
The gene annotaion of m5C sites were retrieved by meRanAnnotate with arguments of ‘-f 'gene' -g Homo_sapiens.GRCh38.100.gff3‘
Assembly: hg38
Supplementary files format and content: excel file with m5C sites commonly present in preplicates
Supplementary files format and content: excel file with differential gene expression data between groups
Supplementary files format and content: tab-delimited txt files of HTseq-count reads counts of each sample
|
| |
|
| Submission date |
Sep 26, 2024 |
| Last update date |
Nov 15, 2024 |
| Contact name |
Po-Hsien Joseph Huang |
| Organization name |
National Cheng Kung University
|
| Department |
Biochemistry and Molecular Biology
|
| Lab |
Dr. Huang Laboratory
|
| Street address |
1 University Rd.
|
| City |
Tainan City |
| State/province |
NA |
| ZIP/Postal code |
701 |
| Country |
Taiwan |
| |
|
| Platform ID |
GPL34284 |
| Series (1) |
| GSE240569 |
mRNA bisulfite sequencing of pluripotent stem cells and the derived cardiomyocytes |
|
| Relations |
| BioSample |
SAMN43945500 |
| SRA |
SRX26211837 |
