 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 06, 2012 |
| Title |
small RNA sequencing from nrde-2(gg091) mutant C. elegans that underwent smg-1 (center region) RNAi |
| Sample type |
SRA |
| |
|
| Source name |
adult C. elegans
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
genetic background: N2
strain: nrde-2(gg091)
developmental stage: adult
barcode (first 3 nt for fastq files of chip-seq libraries, first 4 nt for fastq files of small rna libraries): CGTC
RNAi target: chrI:6,907,993-6,909,159 (smg-1)
|
| Treatment protocol |
Small RNA was extracted from frozen tissue samples with the mirVana microRNA (miRNA) isolation kit (Ambion).
|
| Growth protocol |
RNAi by feeding was carried out as previously described (Timmons, L. & Fire, A. Specific interference by ingested dsRNA. Nature 395, 854 (1998).)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Libraries of small RNAs were prepared using a protocol similar to one previously described for miRNA cloning (LAU, N. C., L. P. LIM, E. G. WEINSTEIN and D. P. BARTEL, 2001 An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294: 858–862.), in which small RNA species were flanked by adapter sequences to allow for PCR and sequencing. We modified the original protocol at several key steps to allow for capture of triphosphorylated species and for sequencing with the Illumina genome analyzer system. To remove the bias for 5′ monophosphorylated species but preserve the bias toward 3′ hydroxylated species, we removed both monophosphates and polyphosphates from the 5′-end of the small RNA with Antarctic Phosphatase (New England Biolabs) following the addition of the 3′ adapter with T4 RNA ligase 1 (New England Biolabs). The resulting hydroxylated 5′-ends were phosphorylated by treatment with T4 polynucleotide kinase (New England Biolabs) and ATP to form a subtrate for T4 RNA ligase 1-mediated addition of the 5′ adapter. T4 polynucleotide kinase treatment after addition of the 3′ adapter is important because of its 3′ phosphatase and 2′,3′ cyclic phosphodiesterase activity, which can convert unwanted RNA degradation products into a substrate for the 3′ adapter ligation reaction. After ligation of both the 3′ and 5′ adapters, the adapters were extended during the reverse transcription and PCR steps to include complete primer binding sites for subsequent amplification and sequencing reactions. To protect against cross-contamination and to allow for pooling of samples, we modified the 5′ adapter sequence to include the Illumina genomic sequencing primer immediately followed by a 4-nt barcode. The samples were PAGE purified at three stages: after initial RNA extraction and after each ligation step (except with the isolated spermatogenic cell sample, where the first PAGE purification was skipped to conserve material). The following oligos were used: 3′ adapter (IDT linker-1 with 5′ adenylation and 3′ dideoxyC): rAppCTGTAGGCACCATCAATC; 5′ adapter (i.e., AF-PP-341 DNA/RNA hybrid oligo with a 5′ amino modifier and 4-nt barcode at the 3′-end): ACGCTCTTCCGATCTrGrUrUrA; Dual reverse transcription primer and PCR primer (AF-JIG-37, complementary to IDT linker-1): CAAGCAGAAGACGGCATACGAattgatggtgcctacag; PCR primer (AF-JIG-40, containing 5′ adapter sequence): AATGATACGGCGACCACCGACACTCTTTCCCTACACGACGCTCTTCCGATCT.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
SG0511_lib1.bed; genome build: C. elegans, May 2008 (WS190/ce6)
For each 36-nt sequence tag, remove the 4-nt barcode from the 5' end and removing sequences that correspond the linker sequence (CTG TAG GCA CCA TCA AT) from the 3' end. The remaining sequence was used to align to the C. elegans genome (WS190 version) using Bowtie 0.12.7. Only perfect alignments were included in the bed file.
|
| |
|
| Submission date |
Dec 29, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Sam Guoping Gu |
| E-mail(s) |
[email protected]
|
| Organization name |
Rutgers University
|
| Department |
Molecular Biology and Biochemistry
|
| Lab |
Sam Gu
|
| Street address |
Nelson Labs A125, 604 Allison Road
|
| City |
Piscataway |
| State/province |
NJ |
| ZIP/Postal code |
08854 |
| Country |
USA |
| |
|
| Platform ID |
GPL13776 |
| Series (1) |
| GSE32631 |
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint |
|
| Relations |
| SRA |
SRX113615 |
| BioSample |
SAMN00769205 |
| Named Annotation |
GSM855093_SG0511_lib1.bed.gz |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM855093_SG0511_lib1.bed.gz |
97.8 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
