 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 05, 2024 |
| Title |
HeLa_pgR-poor_DOX pos_replicate1 |
| Sample type |
SRA |
| |
|
| Source name |
HeLa
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: HeLa
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
gDNA was isolated using a DNA purification kit (Qiagen, 51106), according to the manufacturer’s instructions
gDNA was digested overnight at 37°C with each of the restriction endonucleases MseI (NEB, R0525L) and BglII (NEB, R0144L). Linker oligonucleotides, which were compatible for ligation with the MseI-generated DNA ends, were ligated with gDNA overnight at 12°C in reactions containing 1.5 μM ligated linker, 1 μg fragmented DNA, and 800 U T4 DNA ligase (NEB, M0202S). Viral LTR–host DNA junctions were amplified using semi-nested PCR with a unique linker-specific primer and LTR primers. The second round of PCR was carried out with primers binding to the LTR and the linkers for next-generation sequencing. Two PCRs were performed in parallel for the first round of PCR and five PCRs were performed in parallel for the second round of PCR to enhance library diversity.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
vDNA_integration_seq_result.csv
|
| Data processing |
Quality control of HIV-1 integration site-sequencin reads was performed using FastQC v0.11.9.
To discard primers and linkers specific for integration site-sequencing from reads, we used Cutadapt v2.8 with the following option: "-u 49 -U 38 --minimum-length 36 --pair-filter any --action trim -q0,0 -a linker -A TGCTAGAGATTTTCCACACTGACTGGGTCTGAGGG -A GGGTCTGAGGG --no-indels --overlap 12"
Processed reads were aligned to the hg38 reference genome using bwa v0.7.17-r1188
Assembly: hg38
Supplementary files format and content: BED files - Genomic locations of the identified integration sites
Supplementary files format and content: csv file - Locations of the identified integration sites within the vector and their frequencies
Library strategy: Integration-site-seq
|
| |
|
| Submission date |
Nov 04, 2024 |
| Last update date |
Nov 05, 2024 |
| Contact name |
Dohoon Lee |
| E-mail(s) |
[email protected]
|
| Organization name |
Seoul National University
|
| Department |
Bioinformatics Institute
|
| Street address |
1, Gwanak-ro, Gwanak-gu
|
| City |
Seoul |
| ZIP/Postal code |
08826 |
| Country |
South Korea |
| |
|
| Platform ID |
GPL20795 |
| Series (1) |
| GSE281026 |
Human immunodeficiency virus-1 targets genomic R-loops of the host for integration [IS-seq] |
|
| Relations |
| BioSample |
SAMN44572099 |
| SRA |
SRX26600999 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
