GEO Profile Links for Gene (Select 11771) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 74840231.

Ap2a1 - MPSS transcriptome analysis project

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAACCCTGAGAACTT (ID_REF), GDS868, BC031433

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7484023

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968426172.

Ap2a1 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL6246, 10562965 (ID_REF), GDS4486, NM_001077264, NM_007458, XM_006540569, BC031433, X14971, chr7:44900373-44929490 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96842617

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619492153.

Ap2a1 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1460724_at (ID_REF), GDS3598, 11771 (Gene ID), NM_007458

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61949215

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 32271454.

Ap2a1 - Malaria resistance

Annotation:: Ap2a1, Adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL519, 1645 (ID_REF), GDS471, AW544216

DataSet type:: Expression profiling by array, log ratio, 14 samples

ID:: 3227145

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1217829995.

Ap2a1 - Lipopolysaccharide effect on fatty acid-loaded peritoneal macrophages in vitro

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3143246 (ID_REF), GDS5311, NM_001077264, AP2A1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 121782999

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756547626.

Ap2a1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL6481, 3990309 (ID_REF), GDS4002, NM_007458, Ap2a1 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75654762

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1123374157.

Ap2a1 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1460724_at (ID_REF), GDS5091, 11771 (Gene ID), NM_007458

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112337415

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 454777158.

Ap2a1 - Vitamin E supplementation effect on aged brain

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1460724_at (ID_REF), GDS2973, 11771 (Gene ID), NM_007458

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45477715

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1165215119.

Ap2a1 - B-cell leukemia/lymphoma 11B overexpression effect on brain striatal cells in vitro

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2604688 (ID_REF), GDS5180, NM_007458

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116521511

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6803018910.

Ap2a1 - Snord116del mutant hypothalamus response to neonatal starvation

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2604688 (ID_REF), GDS3786, NM_007458

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 68030189

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7940591711.

Ap2a1 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL6246, 10562965 (ID_REF), GDS4116, NM_001077264, NM_007458, XM_006540569, BC031433, X14971, chr7:44900373-44929490 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79405917

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5544401512.

Ap2a1 - Chromatin remodeling component BAF250a deficiency effect on embryonic stem cells in vitro

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1460724_at (ID_REF), GDS3387, 11771 (Gene ID), NM_007458

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 55444015

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1097817613.

Ap2a1 - Telomere dysfunction effect on male germ cells

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL81, 101357_at (ID_REF), GDS1248, 11771 (Gene ID), X14971

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 10978176

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2742720714.

Ap2a1 - Triple-fusion reporter gene effect on embryonic stem cells

Annotation:: Ap2a1, Adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1307, 18863 (ID_REF), GDS2187, AW544216, C0179B03-3 (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 27427207

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762172315.

Ap2a1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAACCCTGAGAACTT (ID_REF), GDS878, BC031433

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7621723

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11652251816.

Ap2a1 - B-cell leukemia/lymphoma 11B overexpression effect on brain striatal cells in vitro

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3143246 (ID_REF), GDS5180, NM_001077264

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116522518

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4401161517.

Ap2a1 - Various brain regions of several inbred strains

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1460724_at (ID_REF), GDS2917, 11771 (Gene ID), NM_007458

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 44011615

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1464120418.

Ap2a1 - Neuromuscular degeneration mutant spinal cord response to neural stem cell transplantation

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL339, 1460724_at (ID_REF), GDS1468, 11771 (Gene ID), NM_007458

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 14641204

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 438987619.

Ap2a1 - Erythroid differentiation: G1E model

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL81, 101357_at (ID_REF), GDS568, 11771 (Gene ID), X14971

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 4389876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1209031520.

Ap2a1 - Age effect on lipopolysaccharide-induced neuroinflammation and sickness behavior

Annotation:: Ap2a1, adaptor-related protein complex 2, alpha 1 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1460724_at (ID_REF), GDS1311, 11771 (Gene ID), NM_007458

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 12090315

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 11771) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity