GEO Profile Links for Gene (Select 320740) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 19

Select item 44576411.

D830012I16Rik - Preimplantation development

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL870, 11841 (ID_REF), GDS578, AK085805, H3123H06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4457641

GEO DataSets Gene Profile neighbors

Select item 971411052.

D830012I16Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100082200_TGI_at (ID_REF), GDS4495, AK031521

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97141105

GEO DataSets Gene Profile neighbors

Select item 44480583.

D830012I16Rik - Preimplantation development

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL870, 2258 (ID_REF), GDS578, AK085805, C0306A04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4448058

GEO DataSets Gene Profile neighbors

Select item 44713584.

D830012I16Rik - Zygotic gene activation

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL870, 2258 (ID_REF), GDS579, AK085805, C0306A04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4471358

GEO DataSets Gene Profile neighbors

Select item 625717315.

D830012I16Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl24182.1.2197_83-S (ID_REF), GDS3621, D830012I16Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62571731

GEO DataSets Gene Profile neighbors

Select item 44809416.

D830012I16Rik - Zygotic gene activation

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL870, 11841 (ID_REF), GDS579, AK085805, H3123H06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4480941

GEO DataSets Gene Profile neighbors

Select item 643815057.

D830012I16Rik - Hypertension model: heart

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100082200_TGI_at (ID_REF), GDS3673, AK031521

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64381505

GEO DataSets Gene Profile neighbors

Select item 619713318.

D830012I16Rik - Eset depletion effect on embryonic stem cell

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl24182.1.2197_83-S (ID_REF), GDS3599, D830012I16Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61971331

GEO DataSets Gene Profile neighbors

Select item 44735299.

D830012I16Rik - Zygotic gene activation

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4429 (ID_REF), GDS579, AK031521, AK047576, C0933H05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4473529

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6442110510.

D830012I16Rik - Hypertension model: liver

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100082200_TGI_at (ID_REF), GDS3674, AK031521

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64421105

GEO DataSets Gene Profile neighbors

Select item 613855811.

D830012I16Rik - Blastocyst dormancy and activation comparison

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL870, 2258 (ID_REF), GDS752, AK085805, C0306A04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6138558

GEO DataSets Gene Profile neighbors

Select item 6446070512.

D830012I16Rik - Hypertension model: kidney

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100082200_TGI_at (ID_REF), GDS3675, AK031521

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64460705

GEO DataSets Gene Profile neighbors

Select item 614072913.

D830012I16Rik - Blastocyst dormancy and activation comparison

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4429 (ID_REF), GDS752, AK031521, AK047576, C0933H05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6140729

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 445022914.

D830012I16Rik - Preimplantation development

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 4429 (ID_REF), GDS578, AK031521, AK047576, C0933H05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4450229

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6434190515.

D830012I16Rik - Hypertension model: aorta

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100082200_TGI_at (ID_REF), GDS3672, AK031521

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64341905

GEO DataSets Gene Profile neighbors

Select item 614814116.

D830012I16Rik - Blastocyst dormancy and activation comparison

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL870, 11841 (ID_REF), GDS752, AK085805, H3123H06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6148141

GEO DataSets Gene Profile neighbors

Select item 764207417.

D830012I16Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAGGCAGACGAAATA (ID_REF), GDS878, AK085805

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7642074

GEO DataSets Gene

Select item 750437418.

D830012I16Rik - MPSS transcriptome analysis project

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAGGCAGACGAAATA (ID_REF), GDS868, AK085805

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7504374

GEO DataSets Gene

Select item 9785410519.

D830012I16Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: D830012I16Rik, RIKEN cDNA D830012I16 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100082200_TGI_at (ID_REF), GDS4527, AK031521

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97854105

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320740) (19)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 19

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity