GEO Profile Links for Gene (Select 66579) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 86

<< First< Prev

Page of 5

Next >Last >>

Select item 978628861.

2610007O09Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102333_TGI_at (ID_REF), GDS4527, AK019189

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97862886

GEO DataSets Gene Profile neighbors

Select item 971498862.

2610007O09Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102333_TGI_at (ID_REF), GDS4495, AK019189

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97149886

GEO DataSets Gene Profile neighbors

Select item 716711443.

2610007O09Rik - Fasting effect on multiple tissues: time course

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL11012, 5644 (ID_REF), GDS3893, AK011339

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71671144

GEO DataSets Gene

Select item 644694864.

2610007O09Rik - Hypertension model: kidney

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102333_TGI_at (ID_REF), GDS3675, AK019189

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64469486

GEO DataSets Gene Profile neighbors

Select item 644298865.

2610007O09Rik - Hypertension model: liver

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102333_TGI_at (ID_REF), GDS3674, AK019189

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64429886

GEO DataSets Gene Profile neighbors

Select item 643902866.

2610007O09Rik - Hypertension model: heart

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102333_TGI_at (ID_REF), GDS3673, AK019189

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64390286

GEO DataSets Gene Profile neighbors

Select item 643506867.

2610007O09Rik - Hypertension model: aorta

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102333_TGI_at (ID_REF), GDS3672, AK019189

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64350686

GEO DataSets Gene

Select item 625547458.

2610007O09Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl20015.1.1_59-S (ID_REF), GDS3621, 2610007O09Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62554745

GEO DataSets Gene Profile neighbors

Select item 619543459.

2610007O09Rik - Eset depletion effect on embryonic stem cell

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl20015.1.1_59-S (ID_REF), GDS3599, 2610007O09Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61954345

GEO DataSets Gene Profile neighbors

Select item 4996436410.

2610007O09Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1226749_1 (ID_REF), GDS3148, AK011339

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49964364

GEO DataSets Gene Profile neighbors

Select item 3030826311.

2610007O09Rik - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m17499_at (ID_REF), GDS2327, 2610007O09 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30308263

GEO DataSets Gene Profile neighbors

Select item 2158651512.

2610007O09Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL1942, 36515 (ID_REF), GDS1882, AK011339

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21586515

GEO DataSets Gene Profile neighbors

Select item 2158651413.

2610007O09Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL1942, 36514 (ID_REF), GDS1882, AK011339

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21586514

GEO DataSets Gene Profile neighbors

Select item 761368314.

2610007O09Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAAGTTTGGGGCCAG (ID_REF), GDS878, AK011339

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7613683

GEO DataSets Gene

Select item 747598315.

2610007O09Rik - MPSS transcriptome analysis project

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATAAGTTTGGGGCCAG (ID_REF), GDS868, AK011339

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7475983

GEO DataSets Gene

Select item 464176316.

2610007O09Rik - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m17499_at (ID_REF), GDS592, 2610007O09 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4641763

GEO DataSets Gene Profile neighbors

Select item 221175417.

2610007O09Rik - Ligand screen in B cells: untreated

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL260, 9022 (ID_REF), GDS323, AK011339

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2211754

GEO DataSets Gene Profile neighbors

Select item 220633318.

2610007O09Rik - Ligand screen in B cells: untreated

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL260, 2759 (ID_REF), GDS323, AK019189

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2206333

GEO DataSets Gene Profile neighbors

Select item 219495419.

2610007O09Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL260, 9022 (ID_REF), GDS322, AK011339

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2194954

GEO DataSets Gene Profile neighbors

Select item 218953320.

2610007O09Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 2610007O09Rik, RIKEN cDNA 2610007O09 gene

Organism:: Mus musculus

Reporter:: GPL260, 2759 (ID_REF), GDS322, AK019189

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2189533

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 5

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 66579) (86)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 86

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity