GEO Profile Links for Gene (Select 68945) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 51

<< First< Prev

Page of 3

Next >Last >>

Select item 18596851.

1500002J14Rik - Ligand screen in B cells: formyl-Met-Leu-Phe

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS302, AK005119

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1859685

GEO DataSets Gene Profile neighbors

Select item 18260852.

1500002J14Rik - Ligand screen in B cells: dimaprit

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS300, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1826085

GEO DataSets Gene Profile neighbors

Select item 21116853.

1500002J14Rik - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS317, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2111685

GEO DataSets Gene Profile neighbors

Select item 22124854.

1500002J14Rik - Ligand screen in B cells: untreated

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS323, AK005119

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2212485

GEO DataSets Gene Profile neighbors

Select item 19268855.

1500002J14Rik - Ligand screen in B cells: insulin-like growth factor 1

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS306, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1926885

GEO DataSets Gene Profile neighbors

Select item 18428856.

1500002J14Rik - Ligand screen in B cells: Epstein Barr virus-induced molecule-1

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS301, AK005119

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1842885

GEO DataSets Gene Profile neighbors

Select item 19436857.

1500002J14Rik - Ligand screen in B cells: interleukin 4

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS307, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1943685

GEO DataSets Gene Profile neighbors

Select item 74828518.

1500002J14Rik - MPSS transcriptome analysis project

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCTCTAAGAAAGTCAC (ID_REF), GDS868, AK005119

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7482851

GEO DataSets Gene

Select item 619516159.

1500002J14Rik - Eset depletion effect on embryonic stem cell

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl129.1.1_27-S (ID_REF), GDS3599, 1500002J14Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61951615

GEO DataSets Gene Profile neighbors

Select item 191008510.

1500002J14Rik - Ligand screen in B cells: interferon gamma

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS305, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1910085

GEO DataSets Gene Profile neighbors

Select item 172528511.

1500002J14Rik - Ligand screen in B cells: B-lymphocyte chemoattractant

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS294, AK005119

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1725285

GEO DataSets Gene Profile neighbors

Select item 201088512.

1500002J14Rik - Ligand screen in B cells: leukotriene B4

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS311, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2010885

GEO DataSets Gene Profile neighbors

Select item 217888513.

1500002J14Rik - Ligand screen in B cells: transforming growth factor-beta

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS321, AK005119

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2178885

GEO DataSets Gene Profile neighbors

Select item 209488514.

1500002J14Rik - Ligand screen in B cells: prostaglandin E2

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS316, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2094885

GEO DataSets Gene Profile neighbors

Select item 106028515.

1500002J14Rik - Platform type/amplification method cross comparison (16K cDNA)(II)

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS225, AK005119

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1060285

GEO DataSets Gene Profile neighbors

Select item 189328516.

1500002J14Rik - Ligand screen in B cells: interferon beta

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS304, AK005119

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1893285

GEO DataSets Gene Profile neighbors

Select item 207808517.

1500002J14Rik - Ligand screen in B cells: platelet activating factor

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS315, AK005119

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2078085

GEO DataSets Gene Profile neighbors

Select item 4996577918.

1500002J14Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1225749_1 (ID_REF), GDS3148, AK005119

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49965779

GEO DataSets Gene Profile neighbors

Select item 7168612719.

1500002J14Rik - Fasting effect on multiple tissues: time course

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL11012, 20627 (ID_REF), GDS3893, AK005119

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71686127

GEO DataSets Gene Profile neighbors

Select item 179248520.

1500002J14Rik - Ligand screen in B cells: CGS-21680 hydrochloride (adenosine)

Annotation:: 1500002J14Rik, RIKEN cDNA 1500002J14 gene

Organism:: Mus musculus

Reporter:: GPL260, 9938 (ID_REF), GDS298, AK005119

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1792485

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 68945) (51)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 51

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity