GEO Profiles Links for Nucleotide (Select 12846536) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 43

<< First< Prev

Page of 3

Next >Last >>

Select item 978414901.

2410164B09Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090005_TGI_at (ID_REF), GDS4527, AK010824

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97841490

GEO DataSets Gene Profile neighbors

Select item 971284902.

2410164B09Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090005_TGI_at (ID_REF), GDS4495, AK010824

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97128490

GEO DataSets Gene Profile neighbors

Select item 644480903.

2410164B09Rik - Hypertension model: kidney

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090005_TGI_at (ID_REF), GDS3675, AK010824

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64448090

GEO DataSets Gene Profile neighbors

Select item 644084904.

2410164B09Rik - Hypertension model: liver

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090005_TGI_at (ID_REF), GDS3674, AK010824

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64408490

GEO DataSets Gene Profile neighbors

Select item 643688905.

2410164B09Rik - Hypertension model: heart

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090005_TGI_at (ID_REF), GDS3673, AK010824

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64368890

GEO DataSets Gene Profile neighbors

Select item 643292906.

2410164B09Rik - Hypertension model: aorta

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100090005_TGI_at (ID_REF), GDS3672, AK010824

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64329290

GEO DataSets Gene

Select item 76275217.

2410164B09Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAACCTGTGAGTGGTCT (ID_REF), GDS878, AK010824

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7627521

GEO DataSets Gene

Select item 74898218.

2410164B09Rik - MPSS transcriptome analysis project

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAACCTGTGAGTGGTCT (ID_REF), GDS868, AK010824

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489821

GEO DataSets Gene

Select item 22103279.

2410164B09Rik - Ligand screen in B cells: untreated

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS323, AK010824

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2210327

GEO DataSets Gene Profile neighbors

Select item 219352710.

2410164B09Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS322, AK010824

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2193527

GEO DataSets Gene Profile neighbors

Select item 217672711.

2410164B09Rik - Ligand screen in B cells: transforming growth factor-beta

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS321, AK010824

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2176727

GEO DataSets Gene Profile neighbors

Select item 215992712.

2410164B09Rik - Ligand screen in B cells: terbutaline

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS320, AK010824

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2159927

GEO DataSets Gene Profile neighbors

Select item 214312713.

2410164B09Rik - Ligand screen in B cells: secondary lymphoid-organ chemokine

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS319, AK010824

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2143127

GEO DataSets Gene Profile neighbors

Select item 212632714.

2410164B09Rik - Ligand screen in B cells: stromal cell derived factor-1

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS318, AK010824

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2126327

GEO DataSets Gene Profile neighbors

Select item 210952715.

2410164B09Rik - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS317, AK010824

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2109527

GEO DataSets Gene Profile neighbors

Select item 209272716.

2410164B09Rik - Ligand screen in B cells: prostaglandin E2

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS316, AK010824

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2092727

GEO DataSets Gene Profile neighbors

Select item 207592717.

2410164B09Rik - Ligand screen in B cells: platelet activating factor

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS315, AK010824

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2075927

GEO DataSets Gene Profile neighbors

Select item 205912718.

2410164B09Rik - Ligand screen in B cells: neuropeptide Y

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS314, AK010824

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2059127

GEO DataSets Gene Profile neighbors

Select item 204232719.

2410164B09Rik - Ligand screen in B cells: nerve growth factor

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS313, AK010824

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2042327

GEO DataSets Gene Profile neighbors

Select item 202552720.

2410164B09Rik - Ligand screen in B cells: macrophage inflammatory protein-3

Annotation:: 2410164B09Rik, RIKEN cDNA 2410164B09 gene

Organism:: Mus musculus

Reporter:: GPL260, 7378 (ID_REF), GDS312, AK010824

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2025527

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12846536) (43)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 43

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity